Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-12 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.

frEx479 [F57F4.4p::GFP + col-12p::DsRed]. Pick DsRed+ animals to maintain array. Constitutive GFP expression in posterior intestinal cells induced upon infection with Photorhabdus luminescens in posterior intestinal cells. Reference: Julien-Gau I, et al. Dev Comp Immunol. 2014 Feb;42(2):132-7.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.

frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454

frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. The nlp-29p::GFP reporter is induced in the epidermis upon infection with Drechmeria coniospora, wounding and osmotic stress. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Slo, Sma, and Dpy at 25C. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Constitutive expression of antimicrobial peptide nlp-29. Maintain under normal conditions. Reference: Lee KZ, et al. Virulence. 2010 May-Jun;1(3):113-22.

frEx113 [(pJL44) transposase + col-12p::DsRed]. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105.

linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-125 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd300.

icbIs4 [chil-27p::GFP + col-12p::mCherry] II. Reference: Osman GA, et al. Curr Biol. 2018 Feb 19;28(4):640-648.e5.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx468 [ogt-1p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Over-expression of OGT-1 in presumptive null mutant ogt-1(dr20) background. gpdh-1p::GFP is induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx469 [dpy-7p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Hypodermal expression of OGT-1 rescues presumptive null allele ogt-1(dr20). gpdh-1p::GFP is induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx470 [nhx-2p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Intestinal expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx471 [myo-3p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Muscle-specific expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx472 [rab-3p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Neuronal expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. K957M mutation introduced into the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The K957M mutation ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. gpdh-1p::GFP reporter is induced in the hypodermis and intestines during hypertonic stress. col-12p::GFP is constitutively expressed in the hypodermis. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. H612A mutation introduced into the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The H612A mutation decreases, but does not completely ablate, the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. gpdh-1p::GFP reporter is induced in the hypodermis and intestines during hypertonic stress. col-12p::GFP is constitutively expressed in the hypodermis. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. H612A mutation introduced into the endogenous ogt-1 locus tagged with C-terminal GFP. OGT-1(H612A)::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. The H612A mutation decreases, but does not completely ablate, the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. TPR domain deleted in the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The TPR domain deletion (128 aa - 583 aa) ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Defective gpdh-1p::GFP induction in the hypodermis and intestine during hypertonic stress. Constitutive col-12p::DsRed expression. Impaired adaptation to hypertonic stress. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. gpdh-1p::GFP reporter is induced in the hypodermis and intestines during hypertonic stress. col-12p::dsRed is constitutively expressed in the hypodermis. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. ogt-1(dr20) was isolated in an ENU screen in parental strain OG119 for mutants with decreased induction of the gpdh-1p::GFP reporter during hypertonic stress. dr20 is a presumptive null allele [Q600STOP]. OG969 has decreased gpdh-1p::GFP induction during hypertonic stress and impaired adaptation to hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. ogt-1(dr20) was isolated in an ENU screen in parental strain OG119 for mutants with decreased induction of the gpdh-1p::GFP reporter during hypertonic stress. dr15 is a presumptive null allele [R267STOP]. OG971 has decreased gpdh-1p::GFP induction during hypertonic stress and impaired adaptation to hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-120. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTCTGGAATCATGTGCATTATTCTAATTCCTGGG right flanking sequence: CTTTACACATATCTACAATATATTCAAAGCTCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTAGATATGTGTAAAGCCC Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-129. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ccgtctggcaccaaatgATGACTGTTGTCCCACA right flanking sequence: AGGAGGCAAGCAACGTCAAGTCTACGAGTCCCTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGACTGTTGTCCCACAAGG Method Reference: G3 (Bethesda).

Homozygous viable. Splicing defect identified by amplicon sequencing.

Homozygous viable. Deletion of 325 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGTCAAGCTGGAGAAGGAAACGGACAATG; Right flanking sequence: GGAGAAAACGGAAACAACGGTGAGCCACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1102 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTTTTTGTGTTGCCAAGGCTAGGTATCTTT. Right flanking sequence: GGGCTAAATGTTTAAAAGAAAGAAACACTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.