Search Strains

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 3088 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve699 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ccctttttgtttgccaagattatcagatga ; Right flanking sequence: TGTGGCTTCTTCTCAGCATCAGCAGCAGCA. sgRNA #1: gccaagattatcagatgatc; sgRNA #2: AAATTGTTTCTCTCCTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 863 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve700 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: cgaatttcaggctcaaATGGGTAACCAGTA ; Right flanking sequence: TGTTGGAGAGACAAAACGACCGTGGTAAtc. sgRNA #1: TGCGTTCTGGTTTCACATAC; sgRNA #2: GTTTTGTCTCTCCAACATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Mid-larval arrest, arrested larvae are somewhat Dpy. Deletion of 980 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested somewhat Dpy larvae (ve701 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aggcagcaggcgcataaacaggaaagtaaa ; Right flanking sequence: tcaggtttaaaaaaaattgagttttaagtt. sgRNA #1: cataaacaggaaagtaaagg; sgRNA #2: GTAGCAGCAGACATgatttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve725 homozygotes), Unc-36 non-GFP mKate+ animals (eT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion balanced by tmC5. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, sterile GFP+ gk5611 homozygotes and non-GFP Mec Unc animals (tmC5 homozygotes). Maintain by picking fertile wild-type GFP+ and checking for proper segregation of progeny. Derived from parental strains VC4540 and FX19666. Left flanking sequence: GATAACTGAAATCTGGATAGAGGAATGGTC. Right flanking sequence: CCCAATTGTTGACTGTACATGTGGCAACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Heterozygotes are WT. hIn1 homozygotes are Unc. tm759 homozygous arrest as early larva with incomplete penetrance (60% at 25C, 50% at 20C, 30% at 18C, and 50% at 15C). Viable tm759 homozygotes show various postembryonic phenotypes (Unc, Dpy, Egl, Mig, Muv).

Homozygous viable. Deletion of 857 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGATCAGCCGTACTATTGATACTCTATG; Right flanking sequence: TGGACGATCATGTGATTCGTGTTGACAAAG. See WormBase Variation gk3769 for details.

Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACAGTGGAATGGTTACCCGGTAATACACCC; Right flanking sequence: AGGTACCACAACGGAGGTAAATTTGAAAAA. See WormBase Variation gk3802 for details.

Homozygous viable. Deletion of 479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATGGCTCCACAACGCAGCAACAATAGCA; Right flanking sequence: AGGAGTCACTGTAGTCAAGTACGTGTATGT. See WormBase Variation gk3808 for details.

Homozygous lethal or sterile deletion balanced by nT1. Deletion of 692 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous nT1 is non-GFP vulvaless hermaphrodite that bags. Left flanking sequence: CTTAATTTTTTAGTGGAAGACGATCATCCA; Right flanking sequence: GGGAACAATTGGATATTGGAAAAGAGTTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion balanced by eT1. Deletion of 738 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTCAACAGTGAAAATTTGAATATGCGCG. Right flanking sequence: AATTGGAATGGAAAAGAGCTGGACGCTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1155 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTCTCTTAATTACTACGAGTGTTACTGG; Right flanking sequence: CGGCTGTTACTTCGTGTGGCGCGACACAAC. See WormBase Variation gk5004 for details.

Homozygous viable. Deletion of 3495 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCATTCTGGGCGAATTTATGATTGCCAATA; Right flanking sequence: GAAGTTGTCCGTGTTGAGCATTTCAATCAC. See WormBase Variation gk5009 for details.

Homozygous viable. Deletion of 1561 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATAAAGGCAAAGTAGAAAATGACCAGCGAG; Right flanking sequence: ATAGGAAAACAAATATTGTTAAAAAATTTA. See WormBase Variation gk5008 for details.

Homozygous viable. Deletion of 2869 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGACAAATCGATATTTGTATCCAGCG; Right flanking sequence: TCTTCCAAGTTCGTGTTCCAGAAAACATGG. See WormBase Variation gk5052 for details.

Homozygous viable. Deletion of 2070 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTCCGATTTAAAACTGTCTCTTCCTCTA; Right flanking sequence: CTGGTCATGTTTTTCGAATATTCCACAATT. See WormBase Variation gk5060 for details.

Homozygous viable. Deletion of 1066 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGTTTTGATTTTAAAGGTATTCCGATG ; Right flanking sequence: ATCGGCATCTAATTTCTAATGCTTCAAGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion balanced by tmC9. Deletion of 4391 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC9 is non-GFP Mec-3 Unc-31. Left flanking sequence: GTGCCAATTTTCCAATTACTTTTGCCGTTT; Right flanking sequence: CATGGAAGTGCACCACAATGATCCAAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion balanced by tmC9. Deletion of 1365 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC9 is non-GFP Mec-3 Unc-31. Left flanking sequence: TATCAAATATTACAGATGAGAAGGGCGTCT; Right flanking sequence: CGTACTCTCTGGCGCGAAAAGCCGATTTAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 529 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAATTTGTAGTCGTCAAGTCCACATTCAGA. Right flanking sequence: ATTGGCATTTGTCTGCAACACAAGTTTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf16 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.

Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf15 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.

ubIs5 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48 and hsp16-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn5.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Him. Resistant to 1 mM levamisole.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Non-Egl. Non-Scrawny. Class IV egl-15 mutation. Supresses the temperature-sensitive Clr phenotype.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Strain is viable at 15-25C. let-60(ga89) is temperature sensitive; however, with the gap-1 in the background the animals still appear somewhat Clr and Muv even at low temperatures.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Vul. Non-Clr at 25C. Poor growers (sub-viable?) at 25C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature sensitive. Nearly WT at 15C. At 20C the animals are 18% Muv and brood size is 88. At 25C the animals are 57% Muv and almost sterile (brood size is 6). Males appear to mate poorly - not quantitatively measured but very poor success with matings.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Occasional bags and L1 lethality. ga89 is temperature sensitive. Maintain at 16C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Appear to have DV and bags with some frequencey. Appear to give Clr phenotype at 16C. Occasional Muv seen. Very frequently sterile due to lack of gonad development. Maintain at 16C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. sy96 appears to suppress the Clr phenotype of e1745. Lots of Bags and larval lethals.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. clr-1 is termperature-sensitive.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc. Muv.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egl. Bags at high frequency. Semi-Clr.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. clr-1 is temperature-sensitive. n1779 suppresses clr-1.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egl - moderate to severe bloating. 30% make bags of worms. Clr.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc - recessive kinker. Daf-c at 25C. Egl, Clumpy, Lon, low brood size. Dauers do not recover when moved to 15C in the presence of food. Daf-c, Lon, Clumpy, and fertility defects can be rescued maternally.

syIs188 [POPTOP + unc-119(+)]. Maintain by picking non-Uncs. syIs188 suppresses pry-1(mu38) Muv phenotype. Do not distribute this strain; other labs should request it from the CGC.

Homozygous sterile. Deletion of 1538 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ sterile adults (ve609 homozygotes) and non-Rol non-GFP adults (sc3 homozygotes). Maintain by picking Rol GFP+ adults.

Homozygous larval arrest. Deletion of 1568 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ ve610 homozygotes (larval arrest) and non-Rol non-GFP adults (sc3 homozygotes). Maintain by picking Rol GFP+ adults. Left flanking Sequence: aaaaattactataatatttcgcgatttttt ; Right flanking sequence: aggaaagaacgtcagaaatgaaaatcagaa. rpt-4 sgRNA #1: ttacgaggctcgtcattatt; rpt-4 sgRNA #2: gaaaaaacgaggttctcatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous sterile, Pvl. Deletion of 1629 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ non-Dpy Pvl sterile adults (ve631 homozygotes), Dpy non-GFP (dpy-9(e12) homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: acaatggaaatcggagTTATAATAATTCCT ; Right flanking sequence: CGGTTAGCTTCATaatttctattgaggggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous sterile, Pvl. Deletion of 1266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Pvl, sterile adults (ve645 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)]) homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: cgcgtcaactggaattttctttttccccgg ; Right flanking sequence: ATCAATCTGGCTTGGAGCCAACGTAATGGT. sgRNA #1: aattgagcgtagaaattccg; sgRNA #2: CTCCAAGCCAGATTGATACc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous larval arrest. Deletion of 1099 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ arrested larvae (ve669 homozygotes) and non-Rol non-GFP adults (sc3 homozygotes). Left flanking Sequence: ATTGGAGCAGAGAAATGGGCTGAGAAACGT; Right flanking sequence: atattttacttattttttcttaaatctttt. sgRNA #3: GTTCGAATTCGAAGCGAACG; sgRNA #4: CGGAGGTTTCAAGAGAATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous larval lethal. Deletion of 635 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve697 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ccgaaatgccgcatcgcgtgttgtttagcc; Right flanking sequence: TGGAGCTCGTAAAGGACGTGGTCTTGTCAT. sgRNA #1: atcgcgtgttgtttagccag; sgRNA #2: ATCATCGAGACGGTCTATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Heterozygotes are Slow Uncs and segregate Slow Uncs, mid-larval lethals and severe Uncs. e1152 is a dominant Unc. let-49 also called med-47. SeeWBPaper00004990.

Homozygous viable. Deletion of 536 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTAGTTCTTTAAATGACTACTGTAGTGT; Right flanking sequence: TGGTAACTAATCTCAAATAGATTTTAAATT. See WormBase Variation gk3695 for details.

Homozygous viable. Deletion of 1047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTATTTGGACAACGCTCTGTGCACAAATCA; Right flanking sequence: TGGCTTAACGAATGAAGATAATGGATTCAA. See WormBase Variation gk3700 for details.

Homozygous viable. Deletion of 886 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTACAGAAGTTTTAAGAAAACTGGGTCAAG; Right flanking sequence: AGGAGCAATTGGCTCAGCAGCATCACCAGC. See WormBase Variation gk3768 for details.

Homozygous viable. Deletion of 273 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGATGAACGCTTACAGAGAAACGGATATC; Right flanking sequence: AAGAAATATGTGAAACAAGGACGAGTTTGT. See WormBase Variation gk3771 for details.