acIs101 [F35E12.5p::GFP + rol-6(su1006)]. Rollers. Reference: (2010) J Bio Chem 285(14):10832-40.

sEx10267 [rCes F45E12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10516 [rCesC47E12.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx11304 [rCesR09E12.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx11770 [rCes F49E12.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12365 [rCes C47E12.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx13266 [rCesC04E12.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx13430 [rCesC52E12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs11997 [rCes F49E12.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14764 [rCesT25E12.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15381 [rCes C32E12.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15614 [rCes R02E12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15754 [rCesC52E12.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15806 [rCesT24E12.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx16092[rCesK07E12.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx16165 [rCesR09E12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx124 [K07E12 (III) + pCes1943[rol-6(su1006)]]. segrgnt 2. 20 ng/ul K07E12 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.

sEx579 [R02E12 (X) + pCes1943[rol-6(su1006)]]. 10 ng/ul R02E12 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.

Dpy.

Increased movement quiescence during lethargus. knu568 is a specific in-frame deletion of the TSP1 domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Specific in-frame deletion of the astacin domain in ok3407 background suppresses increased quiescence from the ok3407 allele. Quiescence behavior in this strain is reverted to wild-type. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

nsIs105 [hlh-17p::GFP] I. wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx805 [hlh-17p::caspase12 + hlh-17p::caspase17 + ttx-3p::mCherry + glr-3p::mCherry + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Ablation of CEPsh glia partially suppresses AIY presynaptic maintenance defects in cima-1(wy84) mutants. nsIs105 (hlh-17::GFP) expression labels CEPsh glia. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

Superficially WT. Suppressor of gna-2. Reduced brood counts at all temperatures (very strongly reduced at 26C). Exhibits mating-dependent progressive hermaphrodite sterility. Reduced embryo survival following heat shock.

raEx142 [T05G5.1p::C47E12.5(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.

Superficially wild-type. N-terminal tag of W08E12.7 via CRISPR/Cas9 knock-in of mNeonGreen at W08E12.7 locus. Insertion verified by PCR. Left flank: 5' ttcaatgtttattctttcagatagatcaaa 3'; Right flank: 5' ATGGTTAGAAAGGACAGTGAGAGTAGTTGTTCAAGTGATGG 3' (6 silent mutations). sgRNA: 5' GAAAGCAGCTGCTCCAGCGA 3'

goeIs257 [nas- 38p::d1mGFP::nas-38 3'UTR + unc-119(+)]. Destabilized GFP expressed from the nas-38 promoter; especially visible in hypodermis and excretory system. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs326 [hsp-16.2p::nlp-29::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-29::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs388 [hsp-16.2p::cnc-1::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-1::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs397 [hsp-16.2p::cnc-10::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-10::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs406 [hsp-16.2p::nlp-31::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-31::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs408 [hsp-16.2p::nlp-27::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-27::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs407 [hsp-16.2p::cnc-2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-2::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs410 [hsp-16.2p::cnc-6::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-6::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs411 [hsp-16.2p::cnc-4::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-4::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs412 [hsp-16.2p::cnc-7::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-7::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs431 [hsp-16.2p::nlp-25::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-25::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3091 homozygotes (Sys Unc Psa). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.

Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.

mig-1 confirmed by complementation tests, and cfz-2 by PCR. Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Heterozygotes are GFP+(pharynx) wild-type and segregate GFP+(pharynx) wild-type, GFP-(pharynx) Sys Psa Unc and dead eggs. PIck GFP+(pharynx) wild-type to maintain. Presence of cfz-2 was confirmed by PCR; mig-1 by complementation test. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.

peIs785 [casy-1p::daf-2 E11-E11.5(+c)-E12::EGFP + casy-1p::daf-2 E11-E11.5(+c)-E12(-c)::mRFP]. peIs785 caries a daf-2 splicing reporter expressed in many neurons. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602

seaSi182 [(pCFJ150) (vha-6p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] II. Over-expression of FMO-2 in the intestine. Long-lived. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.

Heterozygotes are WT and segregate WT, DpyUncs, and Sqv which are sterile (probably Mel). The bases 17746 to 19294 of the C52E12 cosmid sequence are deleted and 19295 to 19316 are duplicated. The N terminal 239 bases of coding sequence for sqv-7 are left intact; they are predicted to encode 79 amino acids (of 329 amino acids total) of SQV-7 (followed by a frameshift).

n4599: C47E12.4 deletion from AA12F3.

Dpy. Unc. Abnormal Cell Death.

Mapping strain.