RG3200 |
C. elegans |
ZK809.3(ve700[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 863 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve700 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: cgaatttcaggctcaaATGGGTAACCAGTA ; Right flanking sequence: TGTTGGAGAGACAAAACGACCGTGGTAAtc. sgRNA #1: TGCGTTCTGGTTTCACATAC; sgRNA #2: GTTTTGTCTCTCCAACATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|