| VC3805 |
C. elegans |
gkDf63[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] X. Show Description
Homozygous viable. Deletion of 5664 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACCAAACTAAACGCTCTGGACGTGAACATG; Right flanking sequence: GGGGCGCATTTATAGCAAAAACTTCCCAAT. See WormBase Rearrangement gkDf63 for details.
|
|
| VC3807 |
C. elegans |
gkDf64[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] III. Show Description
Homozygous viable. Deletion of 17117 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGAGTCCTCAACTTTTCATTCTGTTGTA; Right flanking sequence: AGGAAATTGTCCCACAAGTTTGAAATGGTA. See WormBase Rearrangement gkDf64 for details.
|
|
| VC3809 |
C. elegans |
gkDf65[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] X. Show Description
Homozygous viable. Deletion of 7821 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTGTATAAGATTTTATTAAATATGTGCCA; Right flanking sequence: CGGTGAAGTATTTGACTAGATGACCGACGT. See WormBase Rearrangement gkDf65 for details.
|
|
| VC3810 |
C. elegans |
EEED8.4(gk3778[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 331 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATCATTTAGTATTCTATGAGTTGGTCCTC; Right flanking sequence: AGGATGTGGACAGATTGTGAAAACTACAAT. See WormBase Variation gk3778 for details.
|
|
| VC3824 |
C. elegans |
sel-11(gk3792[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2037 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTGGCTCGTGTGTGGCGACTGCGGCCA; Right flanking sequence: CGGACCGTCAACAGATCAAGTCACTTCGGA. See WormBase Variation gk3792 for details.
|
|
| VC3831 |
C. elegans |
C15A7.2(gk3798[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATGTCACAATGTTATCCACAATGTTCACCA; Right flanking sequence: CAAAATATAGAAGGAGCATTTGAGTTGGGT. See WormBase Variation gk3798 for details.
|
|
| VC3882 |
C. elegans |
+/nT1 IV; C50B8.1(gk3855[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
Recessive lethal deletion balanced by nT1. Deletion of 506 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCAATAATTTTGGGAAAAAACTCAAATTC; Right flanking sequence: GGGTATGGCTTCTAAACTTGCTATAACTTC. See WormBase Variation gk3855 for details.
|
|
| VC3888 |
C. elegans |
C13F10.5(gk3841[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1329 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTATACCAAATTGTGATCTTTACATCACCG; Right flanking sequence: AGGGGAGCTATTTAAAATTTGAAACTAAAA. See WormBase Variation gk3841 for details.
|
|
| VC3892 |
C. elegans |
vamp-8(gk3845[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1092 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCAGTTCCTATTTCAAACAAAAAAACTCCA; Right flanking sequence: GGGCTTGTTGCTGTCGTTTTCCATTGACTG. See WormBase Variation gk3845 for details.
|
|
| VC3919 |
C. elegans |
C24A3.1(gk3852[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2821 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCATTGTTATTCAGACACCTGAAAGACCC; Right flanking sequence: TGGAAAAACAGCTGCATCGTCAGATCAACA. See WormBase Variation gk3852 for details.
|
|
| VC3921 |
C. elegans |
zipt-2.1(gk3853[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1823 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAGATCAAAATGACAGCGGATGGCTTTCA; Right flanking sequence: CGGAGATAAATCATTTGGAAAAGATTGCAC. See WormBase Variation gk3853 for details.
|
|
| VC3927 |
C. elegans |
dpyd-1(gk5006[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3743 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATAAAACTTCATTTTCAATTTTTCAGACCT; Right flanking sequence: GGCCCATATGTCACACTCGACAACCAAGAG. See WormBase Variation gk5006 for details.
|
|
| VC3937 |
C. elegans |
B0205.12(gk5015[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTAAAATATGGGTCTCTTCTCGCATCTCCT; Right flanking sequence: TGGAAGACTATCTGAAGCAATACAAAAAGG. See WormBase Variation gk5015 for details.
|
|
| VC3940 |
C. elegans |
Y57G11A.5(gk5018[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1099 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATCAGTTTTTACACTTTTAAATATGTTA; Right flanking sequence: GGGTACTTGGTTGTCAGAGCTATTGCTTTT. See WormBase Variation gk5018 for details.
|
|
| VC3946 |
C. elegans |
F15D4.2(gk5020[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 449 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGTGGGAAGCTGTCGAGGTGCTGATGCCA; Right flanking sequence: TGGAAGAGGATCTTGAAGATTTTCTCTAAA. See WormBase Variation gk5020 for details.
|
|
| VC3948 |
C. elegans |
C37A2.8(gk5022[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1524 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCACCAATAATCTTGTATCATCATTCACCA; Right flanking sequence: TCTTCCTCCGTCAATTCACGTGACGCAAAT. See WormBase Variation gk5022 for details.
|
|
| VC3949 |
C. elegans |
F17C8.9(gk5023[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1071 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACACTTTTTACAGGAAAATTTCTTGTCGA; Right flanking sequence: GGAGCTCTTGCGGCAAGCAATTTAGGATTT. See WormBase Variation gk5023 for details.
|
|
| VC3950 |
C. elegans |
ugt-9(gk5024[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGTTTTCGGAAGGCTTTCTGTAGGGTGAA; Right flanking sequence: GGAGGTGCTGTTGCGTACGACAAATTTGAT. See WormBase Variation gk5024 for details.
|
|
| VC3956 |
C. elegans |
F10C1.9(gk5034[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1139 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAACAAATAATTAGCTGCCTCATTGCCT; Right flanking sequence: CATTTCATGTTCCATCACAGCCATATCGCT. See WormBase Variation gk5034 for details.
|
|
| VC3958 |
C. elegans |
asd-2(gk5036[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3065 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGTTGAACCCGAACCCGCAAGCACCACCC; Right flanking sequence: GGTGGGAGAACCAGAAACGTGTAAATCGAC. See WormBase Variation gk5036 for details.
|
|
| VC3959 |
C. elegans |
ubc-7(gk5037[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 551 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TATTTCGGTTATTTTTCATTGTTTAGACGA; Right flanking sequence: TAGGGAGGATTGCTCCATCTATCTAGAAAT. See WormBase Variation gk5037 for details.
|
|
| VC3961 |
C. elegans |
C49A9.10(gk5039[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 655 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCTGGCTTTTTTCTTGTTCCAAGTGCCG; Right flanking sequence: CACCGTGCTGGTTCTCGGCCATTTGGTGGG. See WormBase Variation gk5039 for details.
|
|
| VC3962 |
C. elegans |
K07H8.9(gk5040[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAAACAAAGATAATGATGAGCACCGGGAA; Right flanking sequence: GTCGGATAGCTGCAAAAAAACAGATAACTG. See WormBase Variation gk5040 for details.
|
|
| VC3966 |
C. elegans |
Y57G11C.36(gk5042[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1197 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCCGAAAAGATGGGAATTGGCGATACGGA; Right flanking sequence: tcaggcagaagatgactctgaaattaaaaa. See WormBase Variation gk5042 for details.
|
|
| VC3967 |
C. elegans |
Y69A2AR.32(gk5043[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCGAAACAATGATAATTATCACGATCAAC; Right flanking sequence: CTGATGTCCACTCCGATGCCGCCTCCAGGA. See WormBase Variation gk5043 for details.
|
|
| VC3973 |
C. elegans |
zipt-13(gk5051[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTGTCAGAGCAATGTTGAGAAATCCTCCT; Right flanking sequence: GTCCTTGTTGAGCATGTATCGCAATGCAAG. See WormBase Variation gk5051 for details.
|
|
| VC3979 |
C. elegans |
ZK185.5(gk5056[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 4521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCGTTTACTTTTCTTGGTTTAATCACTTT; Right flanking sequence: CGCCTGATAATCTTCTAAAACTTTGAACAG. See WormBase Variation gk5056 for details.
|
|
| VC3981 |
C. elegans |
F59G1.4(gk5058[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTACAATAGAGTTCCACTAACGCCAACT; Right flanking sequence: TTTGGTAATTTGCCAAAATTCGACGGTCAT. See WormBase Variation gk5058 for details.
|
|
| VC3992 |
C. elegans |
lron-10(gk5064[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2073 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGAGCACTGAACCAGCTTTTCGCCGCCT; Right flanking sequence: GATGGAGGTCATGCCTAAACGAAACAAAAA. See WormBase Variation gk5064 for details.
|
|
| VC3994 |
C. elegans |
F25H2.3(gk5066[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1526 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCACAATTACGATCAGGTTTTATGTATG; Right flanking sequence: TATTTTTAGAGATCTTCAAACGAAGATCAG. See WormBase Variation gk5066 for details.
|
|
| VC3996 |
C. elegans |
lron-6(gk5068[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1960 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACAGACCACTCAACATAGCCATCACTTCG; Right flanking sequence: TGATACCGTGTGCTTGAGCATGAAGTGGAT. See WormBase Variation gk5068 for details.
|
|
| VC4000 |
C. elegans |
oig-5(gk5072[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTTCTCTGGTGGTAGCGATGATGGTAGAA; Right flanking sequence: GGCTGAAATCAATGCGTGGTAGCCTAAAGA. See WormBase Variation gk5072 for details.
|
|
| VC4003 |
C. elegans |
F54D1.1(gk5076[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCCAAGTCAATATTTTCATTATTTCCTCAT; Right flanking sequence: ATTTGTTACTGAAATCTCAGATAACAATGC. See WormBase Variation gk5076 for details.
|
|
| VT2812 |
C. elegans |
unc-54(e190) I; mir-83(n4638) IV; mir-34(gk437) X. Show Description
Paralyzed. DTC migration defect. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| HR505 |
C. elegans |
unc-59(e261) tba-2(sb51)/hIn1 [unc-54(h1040)] I. Show Description
Dominant temperature sensitive maternal-effect embryonic lethal. Maintain at 15C. Heterozygotes are WT. hIn1 homozygotes are Unc. Early cleavage spindles small and misoriented, cytokinesis often incomplete. Recessive non-temperature sensitive maternal-effect embryonic lethal (but sterile in conjuction with unc-59).
|
|
| JJ1743 |
C. elegans |
par-6(tm1425)/hIn1 [unc-54(h1040)] I; him-8(e1489) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs, dead larvae (par-6 homozygotes) and males.
|
|
| KK818 |
C. elegans |
par-6(zu222) unc-101(m1)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc, and Coilers which give only dead eggs (slightly leaky, but survivors are agametic). zu222 is a strict maternal effect embryonic lethal. Partitioning defect similar to that of par-3; fails to localize PAR-3 protein.
|
|
| PJ1115 |
C. elegans |
gaIs37 IV; ccIs55 V. Show Description
gaIs37 [Ef1a::Dmek hs::mpk-1] IV. ccIs55 [unc-54::lacZ + sup-7(st5)] V. At 20C, 99% of the worms are WT. At 25C, close to 100% of the worms are Muv. Also, a heat-shock at the L2 stage can produce a 80-90% Muv phenotype.
|
|
| PJ1156 |
C. elegans |
sqt-1(sc13) age-1(mg44) II; ccIs55 V; mgEx499. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. mgEx499 [unc-54p::age-1 + mec-7p::GFP]. Left-hand rollers. Long and thin. Maintain at 16C.
|
|
| PJ1166 |
C. elegans |
daf-2(m41) III; ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Arrest as dauers at 25C. Maintain at 15C.
|
|
| RG3042 |
C. elegans |
+/mT1[umnIs52] II; cee-1(ve542[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 1124 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Pvl GFP+ non-mKate2 (ve542 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: GTTTTATGATGCTCTTCAATTCTACCGGAC ; Right flanking sequence: GCTGGTGCACCGGCTCCAGCTCCAGTTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3044 |
C. elegans |
+/mT1[umnIs52] II; rpn-3(ve544[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous arrest at larval stage. Deletion of 1779 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (ve544 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: ttcaaattttaaagggaaATGGCTCCGAAA ; Right flanking sequence: ccgaatgaattttataaggatgaattgcat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3047 |
C. elegans |
+/mT1[umnIs52] II; K12H4.5(ve547[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous lethal. Deletion of 418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal GFP+ non-mKate2 (ve547 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaattaattaatttataatgtgatcctttt ; Right flanking sequence: agtcgtagacgattttcgattttcactgta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3048 |
C. elegans |
M03F4.6(ve548[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30[ubc-17(tmIs1243)] X. Show Description
tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous lethal. Deletion of 2153 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, arrested GFP+ non-mCherry (ve548 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TTTGACTTGTTTGTACCCGCATCTACATTG ; Right flanking sequence: ATCGGGAGTTTCTGCACACTGAGTTCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3055 |
C. elegans |
rpl-4(ve555[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous lethal, heterozygous animals might grow slower than wild-type. Deletion of 1188 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type mKate2+GFP+, and segregate wild-type mKate2+GFP+, arrested GFP+ non-mKate2 (rpl-4 homozygotes), arrested non-GFP mKate2+ (hT1 homozygotes), and dead eggs. Maintain by picking wild-type mKate2+ and GFP+. Left flanking Sequence: ATTTCTTCACGTTGGCCTTTGAAGCCTTGC ; Right flanking sequence: Ttattacctgcaatcaacagaaatagtaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3060 |
C. elegans |
vep-1(ve560[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. B0261.1. Homozygous Let. Deletion of 4055 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve560 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AATGCACAATTTGCATCTCCAAATCCGCCA ; Right flanking sequence: ccgttattttacgactgtcaaatctccatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3061 |
C. elegans |
+/mT1[umnIs52] II; algn-11(ve561[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Lvl. Deletion of 2578 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, arrested GFP+ non-mKate2 larvae (ve561 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: cgatcagtttgaaatccataggaaagtttc ; Right flanking sequence: GAATCCAGAATAAAGGCTGAATGGTATAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3067 |
C. elegans |
+/hT1 [umnIs58] I; erfa-1(ve567[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 2016 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve567 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: cagcacaaatagaatATGAGCGCTCCCGCA ; Right flanking sequence: GGTGGATGTTTCTACTCGCAATTCCAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3071 |
C. elegans |
mlt-2(ve571[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Let. Deletion of 2897 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve571 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gttttcattaaatcaaaatttgtgccacca ; Right flanking sequence: GCAAACCGTCGATctttaagattgtaacat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3077 |
C. elegans |
+/mT1[umnIs52] II; bcas-2(ve577[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Pvul GFP+ non-mKate2 adults (ve577 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaatccaaaaTCAGTTCTCCTGATCCTCTT ; Right flanking sequence: GTAAGTGCTAACGGTTTGGAGCTCATcacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|