dzDf1 [IV:506328 - 698511 deleted]. Pick wild-type GFP+ to maintain. Heterozygotes are wildtype GFP+ and segregate into dead eggs (dzDf1 homozygotes), wild-type GFP+ (Heterozygotes), and Unc (tmC25 homozygotes).

Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP unc-5(tm9708) homozygotes, and GFP+ dead embryos(ve615).

Homozygous sterile. Deletion of 4404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve687 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ATTTCGGCGCTGTTCCAGACGCTGTCGGCG ; Right flanking sequence: aggcactgtgcgcagttttggttcccgcaa. sgRNA #1: TGACAATCAAATCGACTTCC; sgRNA #2: caattttctagaatttccca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous sterile, Pvl. Deletion of 5370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve691 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: tctcttttcagctggaaactgtaaactcct ; Right flanking sequence: TGGGCGATTTTAGCATATCTTCCATGGAAT. sgRNA #1: ttatttaacttcctatctca; sgRNA #2: aactcacTTATACAAGTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous larval lethal. Deletion of 5958 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve693 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CACGTGGTTTTGGTCCTCCAGTCGCCTGCT ; Right flanking sequence: CGGTTCCTTTGAAGTGCTGAGCTCCTTCCT. sgRNA #1: TCAGATTATTATGTCAAAGC; sgRNA #2: GCACTTCAAAGGAACCGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous larval lethal. Deletion of 635 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve697 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ccgaaatgccgcatcgcgtgttgtttagcc; Right flanking sequence: TGGAGCTCGTAAAGGACGTGGTCTTGTCAT. sgRNA #1: atcgcgtgttgtttagccag; sgRNA #2: ATCATCGAGACGGTCTATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous sterile. Deletion of 3719 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve762 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aggacgaaaatcgaattctccgcgattttt ; Right flanking sequence: tatgagctgaagaatattttaaaatagaac. sgRNA #1: cgctcctgggcaccgaattt; sgRNA #2: ctaagtccgatccagtgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous Ste, Pvl. Deletion of 2404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Ste, Pvl adults (ve791 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+.  Left flanking Sequence: gaaattcgaaatctacgcaaaatttcagcg ; Right flanking sequence: agggcaaaaaaaaaattgcttaagcctgag. sgRNA #1: accaaatcacgaaaactaga; sgRNA #2: tgaccccaaccagtttctga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.