Strain Information
| Name | IG256 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | xnp-1(tm678) I. |
| Description | Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59. |
| Mutagen | UV/TMP |
| Outcrossed | x3 |
| Made by | N. Pujol |
| Laboratory | IG |
Sign in
or
register an account if you want to order this strain.