Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59.

B0041.7. External left primer: GAGTCATTCGAGCCAATGGT. External right primer: TCCGAAAAAGAAGAAGCCAA. Internal left primer: TTTACGCAGCAAATCAGCAG. Internal right primer: TCTGTTTGACGGGTACACCA. Internal WT amplicon: 3252 bp. Deletion size: 1353 bp. Deletion left flank: AAACGATAGACACGGAACAGAGATTGAGTG. Deletion right flank: CTTCTTCCTCTGCATCTTCTCTCATTACTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

WT. Synthetic lethal with lin-35/Rb. Lower brood size than WT. High % gonad morphogenesis in lin-35 background.

sEx12073 [rCes B0041.7a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).