Search Strains

More Fields
Strain Species Genotype Add
KK725 C. elegans nop-1(it142) III. Show Description
Recessive maternal effect. Embryos from nop-1 mothers exhibit no pseudocleavage contractions or furrow. The majority of the embryos survive and grow into fertile adults.
KK822 C. elegans par-1(zu310) V. Show Description
Temperature-sensitive maternal effect lethal. Maintain at 15C. At 25C embryos show polarity defects and fail to hatch. Reference: Morton DG, Hoose WA, Kemphues KJ. Genetics. 2012 Aug 10.
KN1510 C. elegans huIs120. Show Description
huIs120 [hsp-16.2p::sfrp-1 + myo-2p::Tomato]. Wild-type under normal culture conditions. Heat-shock (10 min) during embryogenesis causes embryonic lethality and HSN migration defects. Heat-shock (10 min) at hatching causes Ql and QR migration defects. Reference: Harterink M, et al. Development. 2011 Jul;138(14):2915-24.
KP1287 C. elegans nuIs26 IV. Show Description
nuIs26 [cat-1::GFP] IV. nuIs26 contains a full length CAT-1::GFP fusion protein (with GFP fused at the predicted carboxy terminus of CAT-1). This transgene rescues the hyperactive locomotion defect of cat-1(e1111). This strain is slightly sluggish for locomotion and has a high degree of sterility (80%), both of which appear to be associated with the transgene. GFP expression in this strain is similar to the CAT expression pattern described by Duerr et al (1999) J Neurosci 19: 72-84.
KQ2841 C. elegans aat-1(ft1003) IV. Show Description
sf1003 is a CRISPR-engineered deletion in aat-1. aat-1(sf1003) mutants show elevated pumping rates and enhanced learning capacity compared to well-fed wild type animals (similar to nkat-1 mutants). Reference: Lin L, et al. Genes Dev. 2020 Aug 1;34(15-16):1033-1038. doi: 10.1101/gad.339119.120. PMID: 32675325.
KR2365 C. elegans unc-11(e47) I; hEx16. Show Description
hEx16 [C32E7 + rol-6(su1006)]. Segregates 65% Unc Rollers. Semi-sterile: high sterility rate and low brood size. Maintain by picking Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR314 C. elegans C. elegans wild isolate. Show Description
WT var. Kitsilano. Interfertile with N2. See WBG 8(3) 78. Caenorhabditis elegans wild isolate (Tc1 pattern XII). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
KS66 C. elegans tcl-2(mh15) IV. Show Description
Polarity mutant. 0% phasmid fill.
KX15 C. elegans ife-2(ok306) X. Show Description
No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).
KX17 C. elegans ife-4(ok320) X. Show Description
C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).
KX54 C. elegans ifg-1(cxTi9279) II; bcIs39 V. Show Description
bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Temperature-sensitive germ cell apoptosis leading to infertility at 25 C. Apoptosing germ cells are decorated by CED-1::GFP in the gonad. Loss of p170 form of IFG-1 (but not p130 IFG-1) confirmed by Western blot. Escaping eggs are fertilized and embryonic lethal. Mos-1 transposon insertion previously described as ifg-1::mos-1(cxP9279) II; confirmed by triple primer PCR with 5’-ACCAAACTGGGCAAACAAAG-3’, 5’-GCTCAATTCGCGCCAAACTATG-3’, and 5’-CTTCCTGAAATTTGGTTTAACAGT-3’. Homozygous ifg-1::mos yields only 444 bp product. Outcrossed heterozygotes yield both 353 bp (wild type ifg-1) and 444 bp products.
KX84 C. elegans ced-3(n2452) IV; bcIs39 V. Show Description
bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. ced-3 deletion confirmed by genomic triple primer PCR with 5’-AGTTCACCGTGACAGCGTCTCTTC-3’, 5’-CGATTACGACTTGAACTGTATCCGA-3’, and 5’-TCTTGTGTAAACGAGATTTGCAATG-3’. Homozygous ced-3(n2452) yields only 1,110 bp product. Outcrossed heterozygotes yield both 1,411 bp (wild type ced-3) and 1,110 bp products. [NOTE: (11-05-2019) A user has reported this strain exhibits temperature-sensitive sterility when raised at 25C.]
LC141 C. elegans him-8(e1489) IV; cat-4(e3015) V. Show Description
Reduction in serotonin and dopamine, most apparent in young larva; bleach hypersensitivity and cuticle fragility in adult, but less than null mutants. Derived by outcrossing CB7107 six times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
LC144 C. elegans agmo-1(e3016) III. Show Description
General chemical hypersensitivity (including bleach), fragile cuticle. Derived by outcrossing CB7014 five times to N2. [NOTE: the e3016 mutation is TGG>TGA but it affects codon W124, not W130.] Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
LC35 C. elegans cat-4(ok342) V. Show Description
T21C9.2, F32G8.6. Serotonin-deficient by anti-serotonin staining. Bleach hypersensitive. Likely also dopamine-deficient (but not tested). Slightly sickly. External left primer: TTTCTTTTCTTGTTGCGCCT. External right primer: TCGAAAAAGTCTGCTTCGGT. Internal left primer: CGTCTTCCGTTTCTTTTTCG. Internal right primer: TCTTGGAATGTGGGATGTGA. Internal WT amplicon: 2497 bp. Deletion size: 2238 bp. Deletion left flank: CGACTAGATTGATTTCCTTCTGTCCCTTCA. Deletion right flank: CTTGACGGAACAACGCCTCGATCTGATCTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
LC80 C. elegans ptps-1(tm1984) I. Show Description
Serotonin- and dopamine-deficient, tetrahydrobiopterin-deficient, general chemical hypersensitivity, cuticle fragility (rapid disintegration in alkaline bleach), male turning defective (phenotypes appear identical to cat-4 null mutants). Derived by outcrossing FX1984 five times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
LC81 C. elegans cat-4(tm773) V. Show Description
Serotonin and dopamine-deficient, bleach hypersensitive, general chemical hypersensitivity, fragile cuticle. 652 bp deletion removes entire first exon. Derived by outcrossing FX773 five times to N2.
LE2290 C. elegans lqIs126. Show Description
lqIs126 [rack-1::MYC + osm-6::GFP]. lqIs126 rescues sterility, gonadal distal tip cell migration defects, and axon pathfinding defects caused by rack-1(tm2262). Reference: Demarco RS, Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.
LE6897 C. elegans src-1(syb7248)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.
LH191 C. elegans lrp-1(ku156) eqIs1 I; rrf-3(pk1426) II. Show Description
eqIs1 [lrp-1::GFP] I. eqIs1 is a spontaneous insertion of an lrp-1::GFP transgene extremely close to the endogenous lrp-1 gene that completely rescues lrp-1(ku156) Mlt and larval lethality. Reference: Kang YL, et al. Mol Biol Cell. 2013 Feb;24(3):308-18.
LKC34 C. elegans C. elegans wild isolate. Show Description
Caenorhabditis elegans wild isolate. Isolated from Dypsis baronii (palm seed) on June 17, 2005 in Madagascar. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
LSJ1 C. elegans C. elegans wild isolate. Show Description
Caenorhabditis elegans wild isolate. This strain has been grown axenically in liquid culture for several years. It was grown on E. coli OP50 so that it could be raised on agar plates and frozen. It will need to have the E. coli removed. This culture originated at UC Berkeley and was once called C. briggsae UC Berkeley strain. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
LV18 C. elegans unc-45(wc1) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (dauer escapers will be Par and give only dead eggs), and DpyUcs which arrest as dead eggs (range from twitching multicellulars to 3-folds that hatch). [There is a greater percentage of hatchlings when the mother is heterozygous (wc1 dpy-1/+). There may also be the possibility of near complete maternal rescue (near full-sized, sterile Dpys), but this has not been routinely observed in the balanced strain (as opposed to wc1 dpy-1/+).] Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: The dauers are not giving dead eggs-they are giving other dauers. Appears that the Par mutation is no longer present.]
LV19 C. elegans unc-45(wc2) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (escapers will be Par and give only dead eggs) and DpyUncs which are dead eggs (a range of embryonic lethality from multicellular twitchers to 3-folds that do not hatch). Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: the dauers are giving dead eggs.]
LW227 C. elegans mls-2(cc615) X. Show Description
Defects in postembryonic M lineage: randomized cleavage orientations, reduced cell proliferation, cell fate transformation from CCs and BWMs to SMs. About 30% larval and adult lethality.
LX533 C. elegans rgs-6(vs62) X. Show Description
Deletion removes 1465 bp. Removes start site and majority of RGS domain. Has beginning and end sequences AAAAAGATCGAATATCGGTTGT...TATGACGTAGCACAATATCAGG.
MAH68 C. elegans mes-1(bn7) X; adIs2122. Show Description
adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Approx. 50% sterility at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.
MDH38 C. elegans ast-1(gk463) bli-2(e768) unc-4(e120) II; otIs339; otIs355; norEx42. Show Description
otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. norEx42 [ast-1 Cosmid + ttx-3::GFP + dat-1::mCherry]. Rollers. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.
MDH6 C. elegans ast-1(gk463) bli-2(e768) unc-4(e120) II; vtIs1 V; norEx42. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. norEx42 [ast-1(+)(cosmid) + ttx-3::GFP + dat-1::mCherry]. Rollers. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.
MDH7 C. elegans ast-1(gk463) bli-2(e768) unc-4(e120) II; ceh-43(ot406) III; vtIs1 V; norEx42. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. norEx42 [ast-1(+)(cosmid) + ttx-3::GFP + dat-1::mCherry]. Rollers. ot406 has a dopaminergic phenotype. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.
MDH91 C. elegans ast-1(hd1) rol-6(e187) II; ceh-20(ok541) III; vtIs1 V; ceh-40(gk159) X; muEx261. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(ok541); ceh-40(gk159) double mutants is rescued by muEx261.
MDH93 C. elegans ceh-43(ot406) ceh-20(mu290) III; vtIs1 V; ceh-40(gk159) X; muEx261. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP at C terminus + odr-1::RFP(su1006)]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(mu290); ceh-40(gk159) double mutants is rescued by muEx261. ot406 has a dopaminergic phenotype.
MDH95 C. elegans ceh-20(mu290) III; vtIs1 V; ceh-40(gk159) X; muEx261. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(mu290); ceh-40(gk159) double mutants is rescued by muEx261.
MH620 C. elegans lin-45(ku112) dpy-20(e1282) IV. Show Description
Weak hypomorphic allele of lin-45. Animals are Dpy but otherwise appear normal. Occasional larval lethality.
ML2936 C. elegans nmy-1(mc90[nmy-1::gfp]) X. Show Description
Maintain at 15C. nmy-1(mc90) allele induces almost complete sterility at 25C. mc90 is a CRISPR-engineered mutation in nmy-1 at the position corresponding to the allele nmy-2(ne3409) changing NMY-2 Leucine-981 to Proline, which is conserved among nonmuscle myosins. mc90 was introduced in parental strain ML2540, which carries a GFP-tag in the endogenous nmy-1 locus. Reference: Molnar K, et al. Genetics. 2024 Sep 4;228(1):iyae109. doi: 10.1093/genetics/iyae109. PMID: 39053622.
ML2937 C. elegans nmy-2(ne3409) I; nmy-1(mc90[nmy-1::gfp]) X. Show Description
Maintain at 15C. nmy-2(ne3409) allele induces embryonic lethality (cytokinesis defective) at 25C. nmy-1(mc90) allele induces almost complete sterility at 25C. mc90 is a CRISPR-engineered mutation in nmy-1 at the position corresponding to the allele nmy-2(ne3409) changing NMY-2 Leucine-981 to Proline, which is conserved among nonmuscle myosins. mc90 was introduced in parental strain ML2540, which carries a GFP-tag in the endogenous nmy-1 locus. Reference: Molnar K, et al. Genetics. 2024 Sep 4;228(1):iyae109. doi: 10.1093/genetics/iyae109. PMID: 39053622.
MLC1065 C. elegans pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID*) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.
MLC1245 C. elegans drsh-1(luc82[myc::AID*::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.
MLC1726 C. elegans drsh-1(luc82[myc::AID*::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID*::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.
MLC1729 C. elegans drsh-1(luc82[myc::AID*::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID*::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.
MP130 C. elegans sup-40(lb130)/+ I; unc-8(e15) IV; egl-1(n487) V. Show Description
lb130/+ dominantly suppresses the e15 backing defect and causes recessive sterility. Three phenotypes are present in this strain: backing steriles (lb130 homozygotes), backing fertiles which are bloated (heterozygotes), and non-backing coiled Unc animals which are fertile and bloated (sup-40(+)). Maintain strain by picking fertile animals which can back. egl-1(n487) is included in the strain to facilitate identification of lb130 homozygotes, which grow slowly; their sterility contrasts with the bloating of lb130/+ heterozygotes.
MQ1236 C. elegans clk-1(e2519) III; rte-5(qm197) X. Show Description
qm197 suppresses the L2 arrest and sterility of clk-1(e2519) on UQ- bacteria.
MQ1395 C. elegans clk-1(e2519) III; rte-1(qm199) X. Show Description
qm199 suppresses the growth arrest and sterility of clik-1(e2519) on ubi- bacteria.
MQ1403 C. elegans rte-2(qm210) I; clk-1(e2519) III. Show Description
qm210 suppresses the growth arrest and sterility of clik-1(e2519) on UQ- bacteria.
MQ1407 C. elegans clk-1(e2519) III; rte-4(qm213) X. Show Description
qm213 suppresses the growth arrest and sterility of clik-1(e2519) on ubi- bacteria.
MQ1408 C. elegans clk-1(e2519) III; rte-3(qm211) X. Show Description
qm211 suppresses the growth arrest and sterility of clik-1(e2519) on ubi- bacteria.
MQ149 C. elegans mau-6(qm50) V. Show Description
Maternal effect uncoordinated. Progressive paralysis leading to full paralysis and rapid death after the 4th larval moult. Some embryonic and larval lethality.
MQ1766 C. elegans sod-2(ok1030) I; sod-5 (tm1146) sod-1(tm783) II; sod-4(gk101) III; sod-3(tm760) X. Show Description
Normal lifespan. Increased sensitivity to oxidative stress, osmotic stress, cold stress, and heat stress. Slow development, slow physiological rates (thrashing, defecation), and reduced fertility. van Raamsdonk J & Hekimi S. Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5785-90.
MQ177 C. elegans mau-7(qm56) IV. Show Description
Maternal effect uncoordinated. Lethargic, kinky jerky, ratchet-like movements in reverse. Constipated due to frequent absence of the expulsion contraction. 20% embryonic lethality. 16% embryonic lethality.
MQ200 C. elegans mud-1(qm21) III. Show Description
Maternal effect Uncoordinated and Dumpy. High degree of embryonic and larval lethality. Dpy phenotype only partially resuced. Hatchlings are of variable length, with poor movement. Adults are short and show kinky uncoordination.