Strain Information
| Name | ZT46 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | csr-1(fj67) IV/nT1 [qIs51] (IV;V). |
| Description | Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj67) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Intracellular localization of CSR-1 is abnormal in the csr-1(fj67) homozygotes. fj67 is a 60-bp in-frame deletion of the first lysine-rich region (KQKDNFILLDILLKQWAAKK) in CSR-1. The first lysine-rich region in the WT has a FokI site. The deletion can be checked by PCR with the following primers: CACCTGTGATTTTTCGGGGAAC and TGGATTCCTTTTGCTGCAACAG, followed by digestion with FokI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x1 |
| Made by | Hiroaki Tabara |
| Laboratory | YK |
| Reference | Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. |
Sign in
or
register an account if you want to order this strain.