Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys2 is an internal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA1000 cbp-1(ys2) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.

GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]

eif-2alpha(rog3) is a (S49A) substitution allele (I:2073439..2073448; WS220) removing P site and PAM site. eif-2alpha (Y37E3.10) encodes the alpha subunit of eukaryotic translation initiation factor 2 (eIF2). Reference: Rollins J, et al. Loss of eif-2alpha phosphorylation on S49 (mammalian S51) associated with the integrated stress response hastens development in C. elegans. MicroPubl Biol. 2017;2017:10.17912/W2BM1S. doi: 10.17912/W2BM1S. Erratum in: MicroPubl Biol. 2020 Feb 27;2020: PMID: 32292896.

muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249

wbmIs60 [pie-1p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (III:7007600). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs60 can be used to direct germline-specific gene expression from the pie-1 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific pie-1 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs61 [myo-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs61 can be used to direct muscle-specific gene expression from the myo-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs63 [myo-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs61] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs63 exhibits muscle-specific wrmScarlet expression driven the myo-3 promoter. Derived from parental strain WBM1126 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome (wbmIs61). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs65 can be used to direct soma-specific gene expression from the eft-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs66 can be used to direct neuron-specific gene expression from the rab-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific rab-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs67 [eft-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs65] (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs67 exhibits soma-specific wrmScarlet expression driven the eft-3 promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs68 [rab-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs66] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs68 exhibits neuron-specific wrmScarlet expression driven the rab-3 promoter. Derived from parental strain WBM1141 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific rab-3 promoter inserted as a single copy into the C. elegans genome (wbmIs66). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs72 [pie-1p::3XFLAG::GFP::unc-54 3'UTR *wbmIs60] (III:7007600). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs72 exhibits germline-specific GFP expression driven the pie-1 promoter. Derived from parental strain WBM1119 by CRISPR-mediated insertion of GFP downstream of tissue-specific pie-1 promoter inserted as a single copy into the C. elegans genome (wbmIs60). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs81 [eft-3p::3XFLAG::GFP::SKL::unc-54 3'UTR *wbmIs65] (V:8645000). Ubiquitous expression of peroxisome-targeted GFP. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of peroxisome-targeted GFP downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Outcrossed six times to WBM lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.

wbmIs76 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs76 can be used to direct soma-specific gene expression from the eft-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs88 [eft-3p::3XFLAG::dpy-10::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs67]. (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of the soma-specific eft-3 promoter. wbmIs88 exhibits soma-specific dpy-10 and wrmScarlet expression driven the eft-3 promoter. Derived from parental strain WBM1143 by CRISPR-mediated modification of tissue-specific transgene. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs89 [rab-3p::3xFLAG::dpy-10::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs68] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of the neuron-specific rab-3 promoter. wbmIs68 exhibits neuron-specific dpy-10 and wrmScarlet expression driven the rab-3 promoter. Derived from parental strain WBM1144 by CRISPR-mediated modification of tissue-specific transgene. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmEx49 [rab-3p::crtc-1(S76A, S179A)::tdTomato::unc-54 UTR]. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression in neurons. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.

wbmIs118 [myo-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs114] I. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in muscle. wrmScarlet expression in muscle. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs114. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs99 [rab-3p::3xFLAG::rpl-22::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs89] IV. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs89. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

3xFlag tag inserted at N-temrinus of endogenous rpl-22 locus. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments.

wbmIs119 [eft-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs88] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in soma. wrmScarlet expression in soma. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs88. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs131 [nep-17p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs119] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the intestine. wrmScarlet expression in the intestine. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs119. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs133 [rab-3p::3XFLAG::rpl-22::SL2::scarlet::rab-3 3'UTR, *wbmIs127] (V:8645000). N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs127. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmEx57 [acs-2p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.

wbmEx64 [rab-3p::nhr-49(cDNA)::unc-54 3'UTR + myo-3p::mCherry::unc54 3'UTR]. mCherry expression in muscle. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.

wbmEx69 [ges-1p::crtc-1(cDNA S76A, S179A)::tdTOMATO::unc-54 3'UTR]. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression in intestinal cells. Fluorescence may be difficult to see at lower magnifications. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.