Strain Information
| Name | ZT2 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
| Description | Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable. |
| Mutagen | UV/TMP |
| Outcrossed | x1 |
| Made by | Moriguchi/Kuroki |
| Laboratory | ZT |
Sign in
or
register an account if you want to order this strain.