Strain Information

Name ZT65   View On Wormbase
Species C. elegans
Genotypehim-1(e879) I; fjDf1 fjDf2 fjDf3 fjDf4 X.
DescriptionThe CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
Mutagen
Outcrossedx1
Made byHiroaki Tabara
Laboratory YK
Reference Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
Sign in or register an account if you want to order this strain.