Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PD6249 C. elegans ccIs4251 I; tam-1(cc567) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Homozygotes have decreased expression of tandem array transgenes, decreased fertility, and high incidences of males at 25C. Maintain at 15C.
PHX1965 C. elegans nlp-29(syb1965[nlp-29::linker::mKate2]) V. Show Description
Endogenous locus tagged with mKate2 using CRISPR/Cas9. Enables visualisation of this secreted AMP in the cuticle upon genetic or physical cuticle damage. Reference: Pujol N & Bringmann H. 2025. microPublication Biology. A knock-in translational reporter for NLP-29 reveals AMP secretion to the apical extracellular matrices following epidermal damage in Caenorhabditis elegans. 10.17912/micropub.biology.001435.
PHX293 C. elegans nas-38(syb293) X. Show Description
Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
PHX3311 C. elegans casy-1(syb3311[casy-1::gfp11x7]) II. Show Description
syb3311 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous casy-1 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Split-GFP tag inserted into endogenous casy-1 locus using CRISPR/Cas9 with two guide RNAs simultaneously. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
PHX3596 C. elegans tph-1(mg280) pah-1(syb3596) II. Show Description
Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX3601 C elegans pah-1(syb3601) II. Show Description
Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX6153 C. elegans latd-1(syb6153[latd-1::GFP) X. Show Description
C39D10.6. GFP tag inserted at the C-terminus of the endogenous latd-1 locus by CRISPR. Punctate GFP expression in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6333 C. elegans dmsr-1(syb6331 syb6333[FRT::dmsr-1 exons 2-3::FRT]) V. Show Description
Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX6345 C. elegans W02D7.3(syb6345[GFP::W02D7.3]) V. Show Description
GFP tag inserted at the N-terminus of the endogenous W02D7.3 locus by CRISPR. Expression of GFP in pharynx, excretory gland cell, and some additional cells in the head. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6394 C. elegans Y71G12B.26(syb6394[Y71G12B.26::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous Y71G12B.26 locus by CRISPR. Expression of GFP in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6466 C. elegans F36D1.23(syb6466[F36D1.23::tagRFP]) I. Show Description
tagRFP tag inserted at the C-terminus of the endogenous F36D1.23 locus by CRISPR. Strong and specific expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6541 C. elegans spex-2(syb6541[spex-2::SL2::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous spex-2/F36D1.7 locus by CRISPR. Expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6983 C. elegans fig-1(syb6983) V; vap-1(ns831[vap-1::sfGFP]) X; oyIs51. Show Description
oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. fig-1(syb6983) is an engineered deletion removing teh fig-1 coding sequence. fig-1 loss of function causes VAP-1::sfGFP accumulation and dye filling defects. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.
PHX700 C. elegans ilys-4(syb700) IV. Show Description
Complete knock out of gene. Increased L1 arrest sleep/quiescence. Reference: Konietzka et al. 2019. Current Biology (accepted).
PQ425 C. elegans apIs320 II; unc-119(ed3) III; unc-3(e151) let-7(mn112) X. Show Description
apIs320 [let-7::unc-119(+)] II. PQ425 was created by crossing PQ320 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
PQ426 C. elegans apIs404 II; unc-119(ed3) III; unc-3(e151) let-7(mn112) X. Show Description
apIs404 [let-7(delta alg-1-binding site)::unc-119(+)] II. PQ426 was created by crossing PQ404 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
PS1493 C. elegans dpy-20(e1362) IV; syIs9. Show Description
syIs9 [pJMGoQL + (pMH86) dpy-20(+)]. Phenotype of dominant activated Go alpha is lethargic and egg-laying defective - phenotype increases in severity as animal matures and ages. Animals frequently wander to the side of the plate. Animals move with decreased amplitude of sinusoidal waves. Dpy and WT revertants are frequent. Linkage unknown. Do not distribute this strain; other labs should request it from the CGC.
PS4330 C. elegans spe-41(sy693) III; him-5(e1490) V. Show Description
Brood size 13.5 Brood size may increase after many passages. Do not distribute this strain; other labs should request it from the CGC.
PY7505 C. elegans oyIs84. Show Description
oyIs84 [gpa-4p::TU#813 + gcy-27p::TU#814 + gcy-27p::GFP + unc-122p::DsRed]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the gpa-4 promoter and gcy-27 promoter, respectively. ASI is ablated in this strain. Increased dauer formation. Expression of dsRed in coelomocytes. Reference: Beverly M, Anbil S, Sengupta P. J Neurosci. 2011 Aug 10;31(32):11718-27.
QC128 C. elegans paqr-1(tm3262) IV. Show Description
Superficially wild-type. paqr-1(tm3262) have an increased number of small lipid droplets when combined with paqr-2(tm3410) in double mutants. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
QC130 C. elegans paqr-3(ok2229) IV. Show Description
Superficially wild-type. Slight decrease in brood size and locomotion speed. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
QC155 C. elegans nhr-49(et8) I; mdt-15(et14) III. Show Description
This double mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
QC156 C. elegans acs-13(et54) nhr-49(et8) I; mdt-15(et14) III. Show Description
This triple mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The acs-13(et54) mutation (G125R) can be detected using PCR with the following primers: WT FWD: 5´CTA CCA GGG TGT TCG CCA TG 3; acs-13 mutant FWD: 5´CTA CCA GGG TGT TCG CCA TA 3; acs-13 REV: 5´TCA AAC TTG GGC ATT GCT CC 3´. Annealing 65°C, expected product 395 bp. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
QC158 C. elegans paqr-1(et52) IV. Show Description
paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056
QP1208 C. elegans sws-1(ea12) V. Show Description
Increased lethality and male frequency. Synthetic lethal with helq-1(tm2134). Sensitive to camptothecin. Interacts with rip-1 and rfs-1. Reference: McClendon TB, et al. Genetics. 2016 May;203(1):133-45.
QQ250 C. elegans gin-1(cv10). Show Description
Gin is Glucose INtolerant. gin-1(cv10) is a Diet/nutrition-dependent maternal effect embryonic lethal. Lethality is significantly increased with growth on OP50 seeded on glucose supplemented plates. Grown on HB101, HT115 or fresh OP50 (seeded less than five days)
QQ255 C. elegans gsy-1(gk397885) II. Show Description
Maternal-effect, diet/nutrition-dependent embryonic lethal. Strain segregates increased embryonic lethality when grown on glucose, UV-treated OP50, older OP50, and DA837. Lethality is suppressed on fresh OP50 (less than 5 days from seeding), HB101, and HT115.
QQ257 C. elegans gin-2(cv11). Show Description
Gin is Glucose INtolerant. gin-2(cv11) is a Diet/nutrition-dependent maternal effect embryonic lethal. Lethality is significantly increased with growth on OP50 seeded on glucose supplemented plates. 20C, Grown on HB101, HT115 or fresh OP50 (seeded less than five days).
QV98 C. elegans zjIs5 II; unc-119(ed3) III. Show Description
zjIs5 [gst-4p::tdTomato::unc-54 3'UTR + unc-119(+)] II. Single copy insertion into ttTi5605 II. Fluorescence is dim; culture on 2-3 mM acrylamide to increase brightness. Reference: Tang L, et al. G3 (Besthesda). 2015 Dec 28;6(3):551–558. doi: 10.1534/g3.115.023010 PMID: 26715089.
QW1655 C. elegans lin-15B&lin-15A(n765) zfIs149 X. Show Description
zfIs149 [flp-18p(3kb)::mCherry::SL2::FLP-18 + lin-15(+)] X. FLP-18 expressing neurons are labeled with cytosolic mCherry. Overexpression of FLP-18 causes uncoordinated locomotion. Animals exhibit exaggerated head and body bends, increased reversal frequency, and enhanced calcium transients in body-wall muscle. These phenotypes are suppressed by loss of NPR-5. Reference: Florman JT & Alkema MJ. PLOS Genet. 2022 Mar 3;18(3):e1010091. doi: 10.1371/journal.pgen.1010091. PMID: 35239681.
RA454 C. elegans swsn-1(tm4567)/rol-9(sc148) V. Show Description
Heterozygotes are mostly wild-type but occasionally lack a gonad arm; segregate tm4567 homozygotes (larval/embryonic lethal) and rol-9 homozygotes (Rol). Pick non-Rol to maintain and screen for larval lethals (or by PCR) for tm4567 deletion. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
RAF4 C. elegans cey-3(rrr11) cey-2(ok902) I. Show Description
Reduced brood size. cey-3(rrr11) was created using TALENs in the cey-2(ok902) mutant background to produce the double mutant. Reference: Arnold A, et al. Nucleic Acids Res. 2014 Dec 1;42(21):13353-69.
RB2147 C. elegans acs-13(ok2861) I. Show Description
Y65B4BL.5. Homozygous. Outer Left Sequence: TATTCGGCTTTGAGGAGAGC. Outer Right Sequence: AAAGGCCACTGGTGAGTTTG. Inner Left Sequence: TGAACAAATGATTGAGCGACA. Inner Right Sequence: ACCGATGAGCTCAAAACGAC. Inner Primer PCR Length: 1131 bp. Deletion Size: 603 bp. Deletion left flank: GGATCACCATTCCGACGTGTCCGGCTAGCG. Deletion right flank: TGAGTGAGCATCACACCTTTCGGTGTTCCA. [NOTE: ok2861 has been found to be same molecular lesion as ok2815. These alleles are likely two isolates of the same deletion pulled from the screening pool.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3455 C. elegans mcm-2(ve955[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Late larval lethal. Deletion of 5085 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 animals that become increasingly unc and eventually die (ve955 homozygotes) and paralysed dpyunc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TTGACATTCTCAATTCTCAATTGCTGAGCC; Right flanking sequence: CGCGATGGAGCGCGATTGCGCGGGCATGAC. mcm-2 sgRNA A: TTTTCGATGAATTCCGACTC; mcm-2 sgRNA B: ACAGAATTCAAAAGAGGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RM2576 C. elegans cho-1(tm373) IV. Show Description
Canonical allele. Superficially wild-type. Frequency of spontaneous reversals approximately twice that of wild type. Initial L4 swimming rate approximately half that of wild type, and decreases steadily for 30 min, until the animals are immobile. Synthetic lethal with pmt-2 RNAi.
RM3571 C. elegans sup-1(e995 e2636) III. Show Description
Putative null allele; e995 e2636 homozygotes are superficially wild type in appearance, development, and behavior (except for a modest 20-25% decrease in swimming rate), and do not suppress unc-17(e245). e995 corresponds to G84E (gga>>gaa) and e2636 corresponds to W58stop (tgg>>tag). PCR methods for scoring e995 and e2636 mutations in individual worms are presented in the Supporting Information File of Mathews et al., 2012. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM523 C. elegans unc-17(cn355) IV. Show Description
cn355 behaves like other unc-17 hypomorphs (coily Unc, slow growth, aldicarb-resistant, etc.); however, the mutation is in the splice site necessary for generating unc-17 transcripts, so that unc-17 transcripts and UNC-17 protein are dramatically reduced (hence the unc-17 behavioral phenotypes), and the cha-1 transcripts, CHA-1 protein, and ChAT enzyme activity are significantly increased (Mathews et al., 2015). Note: UNC-17 and CHA-1 protein sequences are both completely wild-type; the phenotypes derive from the extremely low level of the (wild-type) UNC-17 protein. Flanking Sequences: AAATTTAGAAAAAATAAAATATTCC/ A>G /GGGGGAGAGAGAGAGATGGGCTTCA (in direction of transcription). Reference: Mathews EA, et al. Genetics. 2015 Mar;199(3):729-37.
RP1 C. elegans trIs10. Show Description
trIs10 [myo-3p::MB::YFP + myo-2p::YFP + ceh-23::HcRed + unc-25::DsRed + unc-129nsp::CFP].
RP2637 C. elegans mev-1(tr357) III. Show Description
Homozygous viable. mev-1(tr357) is a G212A (G71E) missense mutation. mev-1 also known as sdhc-1. Isolated in an F2 screen for resistance to the lethality induced by wact-12. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2639 C. elegans mev-1(tr359) III. Show Description
Homozygous viable. mev-1(tr359) is a C197T (T66I) missense mutation. mev-1 also known as sdhc-1. Isolated in an F2 screen for resistance to the lethality induced by wact-12. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2667 C. elegans mev-1(tr386) III. Show Description
Homozygous viable. mev-1(tr386) is a C197T (T66I) missense mutation. mev-1 also known as sdhc-1. Isolated in a screen for resistance to the lethality induced by wact-12. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2682 C. elegans mev-1(tr395) III. Show Description
Homozygous viable. mev-1(tr395) is a G398A (G133E) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2687 C. elegans mev-1(tr399) III. Show Description
Homozygous viable. mev-1(tr399) is a C197T (T66I) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-12. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2688 C. elegans sdhd-1(tr400) II. Show Description
Homozygous viable. sdhd-1(tr400) is a G283A (D95N) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-12. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2696 C. elegans sdhb-1(tr405) II. Show Description
Homozygous viable. sdhb-1(tr405) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2697 C. elegans sdhb-1(tr406) II. Show Description
Homozygous viable. sdhb-1(tr406) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2698 C. elegans mev-1(tr407) III. Show Description
Homozygous viable. mev-1(tr407) is a G221A (R74K) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2699 C. elegans mev-1(tr408) III. Show Description
Homozygous viable. mev-1(tr408) is a G230A (G77D) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2700 C. elegans sdhd-1(tr409) II. Show Description
Homozygous viable. sdhd-1(tr409) is a T252A (H84Q) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2702 C. elegans mev-1(tr410) III. Show Description
Homozygous viable. mev-1(tr410) is a T407C (F136S) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.