Search Strains

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. dapk-1(gk219) decreases neurodegeneration. Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. pinn-1(tm2235) increases neurodegeneration. Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.

ufIs104 [nlp-12(+) + lgc-11p::GFP]. ufIs104 contains a 1.76 kb PCR product containing the nlp-12 genomic locus (?354 bp to +1407 bp relative to the transcriptional start). Over-expression of nlp-12 results in increased body bend amplitude. This strain has a high rate of sterility but can be successfully maintained as a homozygote. Reference: Bhattacharya R, et al. PLoS Genet. 2014 Aug 28;10(8):e1004584. doi: 10.1371/journal.pgen.1004584. PMID: 25167143.

wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Endogenous dpy-27 locus tagged with AID* element and myc to create a conditional allele using the auxin-inducible degron (AID). In absence of auxin, ~40% of worms are male due to him-8(me4) mutation. In the presence of auxin, ~100% of worms are male (hermaphrodite-lethal due to degradation of AID-tagged DPY-27). Reference: Li Q, et al. Inducible degradation of dosage compensation protein DPY-27 facilitates isolation of Caenorhabditis elegans males for molecular and biochemical analyses. bioRxiv 2022.01.27.478040; doi: https://doi.org/10.1101/2022.01.27.478040.

axIs1460 [pie-1p::GFP::pal-1(genomic)::pal-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. pal-1 coding region and 3’ sequences were amplified from genomic DNA and cloned into pDONR201 to create ORF+3’ Entry Clones.

zuIs60 [pie-1p::GFP(secreted) + unc-119(+)]. Maternally-expressed secreted GFP fills spaces between embryonic cells, and space between embryo and vitelline membrane. Useful marker for vizualizing intercellular spaces in embryos. Reference: Wehman AM, et al. Curr Biol. 2011 Dec 6;21(23):1951-9.

Heterozygotes are WT and GFP+. q568(ts) homozygotes are sterile and can exhibit a white-patch phenotype. The severity of the white-patch increases with increasing temperature. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC.

qSi150 [sygl-1p::3X flag::sygl-1::tbb-2 3' UTR + Cbr-unc-119(+)] II. Phenotypically gravid, grows as a homozygote. Increased SYGL-1 protein expression, expanded progenitor zone, expanded GSC pool. Reference: Shin H. et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.

CRIPSR-engineered modification of gld-1 FBEa* in gld-1 3'UTR.  Homozygotes are fertile with a slight increase in distal GLD-1 protein levels. Reference: Qiu et al., In preparation.

q1242 is an engineered TGT to ACA substitution in FBEa1 of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

Pick GFP+ to maintain. CRIPSR-engineered modification of gld-1 FBEa and FBEa* in gld-1 3'UTR.  Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1243 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Increase in distal GLD-1 protein levels and decrease in proximal GLD-1 protein levels. Qiu et al., in preparation.

Engineered TGT to ACA substitutions in FBEa1 and FBEb of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP q1271 homozygotes (sterile Mog). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by modification of gld-1(q1242) homozygotes from parental strain JK6540. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

Recessive, loss of function, early stop mutation within the coding sequence makes sa603 a likely null allele. Variable locomotion ranging from lethargic to hyperactive. Eat (pale, scrawny). Loopy movement - increased amplitude of locomotory wave-form (variable). Suppresses the enteric muscle contraction (EMC) defect, the lethargy and egg-laying defects of unc-43(n498).

Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotort wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.

seaIs201 [myo-3p::human tau (0N4R;V337M)::unc-54 3'UTR + vha-6p::mCherry::unc-54 3'UTR]. Reduced crawling speed, reduced brood size, shortened lifespan, slow development, early paralysis. Human tau transgene is expressed in body wall muscles, producing strong phenotypes suitable for screening and is sensitive to knockdown by feeding RNAi. Generated in N2 background.

Slowed development. Increased life span. Decreased embyronic viability. Decreased brood sizes.

ceIs201 [unc-17p::ins-22::Venus + unc-17p::RFP + unc-17p::ssmCherry + myo-2p::RFP]; integration site maps to I:0.77. Expresses INS-22::Venus to mark Dense Core Vesicles in the cholinergic nervous system, including the ventral cord cholinergic motor neurons. Also expresses mCherry in the same neurons to help identify the boundaries of the somas, axons, and dendrites. ssmCherry is mCherry with a secretion signal on its N-terminus, which is constitutively secreted and taken up by coelomoctyes in the pseuodcoelomic space, making it a useful marker for those coelomocytes. The INS-22::Venus also gets secreted by DCVs and taken up by coelomocytes. The myo-2::RFP is a co-tranformation marker that lights up the pharyngeal muscle cells and is useful for crossing the integrant into various mutant backgrounds. Reference: Hoover CM, et al. Genetics. 2014 Mar;196(3):745-65.

Decreased brood size. Small body size. Slow growing. Resistant to 5HT serotonin.

tm1095 enhances Q neuroblast migration and vulva induction phenotype of pry-1. Minor defect in excretory cell development. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.

Small, slightly developmentally delayed. Increased Nile Red staining. Slightly more severe than mg360.

Small, slightly developmentally delayed. Increased Nile Red staining.

Wild-type segregating wild-type, Unc-101 (hIn1[unc-101] homozygotes) and arrested crescent-shaped larvae (eDf13 homozygotes, probably L1). Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Wild-type segregating wild-type, Unc-101 (hIn1[unc-101] homozygotes) and arrested crescent-shaped larvae (eDf14 homozygotes, probably L1). Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Animals with the duplication are WT. Animals which have lost the duplication arrest at 3rd larval stage with increased life span. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.

cpSi171 [vha-8p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in multiple tissues including intestine, hypodermis, and excretory cell.

xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchIs15 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C: Prone to transgene suppression at higher temperatures. Rollers. Upon heat shock, human amyloid beta is expressed and secreted into the extracellular space. Aggregates are found in the extracellular space after 16 hours. Generated in N2 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Small body size and 6 coelomocytes. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Tian et al. (2010) Development 137(14):2375-84.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Missing M-derived coelomocytes and 1-3 body wall muscles. Cells transformed to sex myoblast-like fates. myo-3p::ssGFP is a secreted GFP that it taken up by coelomocytes.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Small body size and 6 coelomocytes. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes.

Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

cdb2 cdb72 is a mutation to the 3' end of the mature mir-35 creating a 3’ end containing nucleotides that are not present or rare among all mir-35 family members at a given position, while preserving overall GC content. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.

cdb2 cdb78 is a mutation to the 3' end of the mature mir-35 creating a mutant with mir-35 seed sequence and mir-82 3’ end. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.

Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

Double mutants displayed a severe defect in seam-cell development, implicating a retarded heterochronic phenotype. Protruding vulva phenotype. Increased number of seam cells. Reference: Zhang L, et al. Mol Cell. 2007 Nov 30;28(4):598-613. PMID: 18042455

Superficially wild-type. Identified in a screen for suppressors of the Multivulva (Muv) phenotype in lin-31 loss-of-function (lf) mutants. Reference: Ding L, et al. Mol Cell. 2005 Aug 19;19(4):437-47. PMID: 16109369.

mcIs54 [dpy-7p::spas-1::SL2(operon)::mCherry + unc-119(+)] X. Dpy. Expression of Spastin transgene depletes microtubules specifically in the hypodermis, creating a Dpy phenotype. Reference: Quintin S, et al. Development. 2016 Jan 1;143(1):160-73.

Animals are dye-filling negative. A bit sick with about 30% dying during larval development and the others displaying a number of defects in organs/tissues containing hypodermal cells (hypodermis, rectum, vulva, excretory system).

mcEx337 [vha-5(+)::GFP + rol-6(su1006)]. Animals with the array are Rollers and GFP+ in the excretory canal. Animals which have lost the array are dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).

mcEx342[vha-5(E830Q)::GFP + rol-6(su1006)]. Animals with the array are slightly Dpy and are occasionally Rollers and GFP+ in the excretory canal. Animals which have lost the array are dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).

vha-11 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

vha-1 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

vha-13 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

vha-14 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

vha-8 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

vha gain-of-function alleles created by replacing the miR-1 binding sites (ACATTCCA) in the 3' UTRs of the endogenous loci with a NotI (GCGGCCGC) restriction site. (vha-12 gain-of-function allele was created by replacing three miR-1 binding sites (ACATTCCA) with NotI (GCGGCCGC), BamHI (GGATCC), and EcoRI (GAATTC) restriction sites.) Referred as 6x-vhaNotI. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

dct-1 gain-of-function allele created by replacing two miR-1 binding sites (ACATTCCA) in the 3' UTR of the endogenous locus with NotI (GCGGCCGC) restriction sites. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.