Search Strains

mir-47 pre-miRNA deletion allele in which mir-47 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-81 pre-miRNA deletion allele in which mir-81 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-1829.3 pre-miRNA & F39B1.3 deletion allele in which mir-1829.3 pre-miRNA & F39B1.3 was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-1829.2 pre-miRNA deletion allele in which mir-1829.2 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-4812 pre-miRNA deletion allele in which mir-1824 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mScarlet replacement of mir-61 and mir-250 pre-miRNAs.

mScarlet replacement of mir-61 and mir-250 pre-miRNAs.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Weak-nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are Rol+, mScarlet+ GFP+, and segregate Rol+ mScarlet+ GFP+, Lin-4 Rol mScarlet+ non-GFP (umn80 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Weak-nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are Rol+, mScarlet+ GFP+, and segregate Rol+ mScarlet+ GFP+, Lin-4 Rol mScarlet+ non-GFP (umn83 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet. Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (short sequence). Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

dvIs70 [hsp-16.2p::GFP + rol-6(su1006)]. Roller. Integrated array containg pCL25 (hsp-16-2 promoter/GFP transcriptional fusion) and pRF4. Shows robust induction of GFP expression after heat induction. Not known where dvIs70 is integrated.

dvIs47 [myo-3p::HSP-16.2 + mtl-2p::GFP]. Integrated transgenic strain with constitutive body wall muscle expression of the small heat shock protein HSP-16.2 marked by co-injection of intestinally-expressed mtl-2p::GFP.

dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.

rexIs1 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of Halo protein with TEV recognition site for the tobacco etch virus protease and human Keap1 protein (an established RES sensor). No phenotypic change upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.

rexEx10 [hsp-16p::his-6::Halo + mec-7p::mRFP]. Pick RFP+ to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces the expression of Halo protein.

dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.

rexIs2 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Array is prone to silencing; pick RFP animals to maintain array. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of mCherry with tom70 (outer mitochondrial membrane targeting sequence from yeast) and Halo protein. Global red fluorescence upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.

dvIs19 [gst-4p::GFP::NLS] III. rexEx12 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of mCherry::Halo protein. Oxidative stress induces expression of GFP.

dvIs19 [gst-4p::GFP::NLS] III. rexEx13 [hsp-16p::HA::wdr-23::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of HA::WDR23::Halo protein. Oxidative stress induces expression of GFP.

krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008

Superficially wild-type. Temperature-sensistive. Maintain at 15C. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Animals are sterile or arrest development as larvae at when grown at 20-25C. Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.

Dpy. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.

oxEx166 [HSP::MosTRANSPOSASE + CC::GFP + lin-15(+)]. Should be grown at 25C. Maintain by picking non-Muv. Animals carrying the array should be GFP+.

oxEx166 [HSP::MosTransposase + coelomocyte::GFP + lin-15(+)]. Should be grown at 25C.

oxTi211 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.

oxTi208 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.

oxTi207 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.

oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883

oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Integrated Cas9 transgene linked to unc-119(ox819). Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883

oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883

oxTi1120 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272] I. Inserted into W01A8.6. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883

oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883

oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Outcrossed to remove unc-119 mutation. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883

oxTi1121 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272]) V. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Inserted into W03F9.11. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883

egxSi126 [mex-5p::hsp-3(aa1-19)::halotag::HDEL::pie-1 3’UTR + unc-119(+)] I. Superficially wild-type. Stable expression of Halotag in the ER lumen in the germline and embryos. Reference: Fan X, et al. G3 (accepted).

egxSi145 [mex-5p::hsp-3(aa1-19)::halotag::HDEL::pie-1 3’UTR + unc-119(+)] II. Superficially wild-type. Stable expression of Halotag in the ER lumen in the germline and embryos. Reference: Fan X, et al. G3 (accepted).

krIs14 [hsp-16.48p::MosTransposase + lin-15B + unc-122p::GFP]. GFP expression in coelomocytes. Derived by integration of oxEx166. Reference: Toraason E, et al. STAR Protoc. 2021 Sep 8;2(3):100801. doi: 10.1016/j.xpro.2021.100801. PMID: 34527958.

xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx380 [hsp-16.41p::zif-1::SL2::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. Transgeneic cdc-42 is subject to ZIF-1 dependent degradation. In cells inheriting xnEx380, there is heatshock-dependent expression of ZIF-1 and mCherry. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.

naIs3 [(pGC133) hsp-16.41::FLP:::let-858 3'UTR) + Cbr-unc-119(+)].

naIs6 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+) + ceh-22p::GFP)].

naEx75 [(pGC146) hsp-16.2p::FLP::let-858 3'UTR) + Cbr-unc-119(+) + (pCW2.1) ceh-22p::GFP)]. Array was bombarded but did not integrate.

naIs7 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+)]. Does not express ceh-22p::GFP, but unc-119 is rescued.

zcIs13 [hsp-6p::GFP + lin-15(+)] V. Stable transgenic line with GFP expression mainly in the posterior intestine, observed from L1 to adult. Perturbation of mitochondrial folding environment induces robust GFP expression throughout the intestines. Derived by outcrossing parental strain SJ4100 to N2 six times to remove suspected background mutations causing uneven transgene expression and low penetrance of sterility.

C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.

Removed from distribution. Reportedly heterozygous for mg585. GR2252 provided as a replacement. Slow growth. Low brood size. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.

mgIs73 [cyp-14A4p::GFP::cyp-14A4 3’UTR + myo-2p::mCherry] V. Slow growth. Low brood size. Received as a replacement for GR2249. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.

arIs36 [(pJF43) hsp::ssGFP + dpy-20(+) + pBluescript SK+]. GFP is secreted into the pseudocoelom upon heat shock and is taken up by coelomocytes. Not known where arIs36 is attached. Do not distribute this strain; other labs should request it from the CGC.

xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.