Search Strains

zcIs9 [hsp-60::GFP + lin-15(+)]. Stable transgenic line with low basal GFP expression, mainly in the tail, observed from L1 to adult. Induced by perturbations of mitochondrial folding environment.

zcIs13 [hsp-6p::GFP + lin-15(+)]. Stable transgenic line with GFP expression mainly in the tail, observed from L1 to adult. Induced by perturbations of mitochondrial folding environment.

zcIs21 contains [hsp-16p::clpp-1(WT)::3xmyc-His tag + myo-3p::GFP].

zcIs22 contains [hsp-16p::clpp-1(delta SS)::3xmyc-His tag + myo-3p::GFP].

zcIs4 [hsp-4::GFP] V. The identity of upr-1 remains unknown. Animals containing the zc6 mutation can be detected in an hsp-4::GFP background by following the bright green tails under fluorescence microscopy.

Strain contains deletion allele of smc-6 with syIs44 [hsp::lacI::GFP + lacO + dpy-20(+)] V.

ncIs17 contains [hsp-16.2::eGFP + pBluscript]. Superficially wild-type.

zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.

zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.

gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Insertion not mapped.

gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Temperature sensitive. Maintain at 15C.

syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Heatshock induces expression of lacI::GFP in the soma, which binds to integrated lacO arrays. lacI::GFP expression is silenced in the germline. Derived by out-crossing PS2442 to remove e1282. Reference: Severson AF & Meyer BJ. Elife. 2014 Aug 29;3:e03467.

csEx52[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.

csEx53[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.

csEx72[hsp::lin-45ED + sur-5::GFP]. Maintain by picking GFP+.

F43E2.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38E11.1. External left primer: TAAATCGGCAGAAAACGACC. External right primer: TGTTGCTCTCGAATCGTCAC. Internal left primer: AAAATTGTGGCCACCAAAAA. Internal right primer: ATTTCGTTGCTCATTGGTCC. Internal WT amplicon: 1297 bp. Deletion size: 533 bp. Deletion left flank: TGTTCACCATAAGAAACGAGGCGTCTCCTC. Deletion right flank: AAGGAATTCTCCAATGTTCTTCACATCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y22D7AL.5. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAATTGATTTTTCCCGCTGA. External right primer: AGGGGAAAAAGAGCCGTAAA. Internal left primer: GAAATTTTGGTTTTCCTGCG. Internal right primer: CAAATGGCTCAGAGCACAAA. Internal WT amplicon: 1227 bp. Deletion size: 611 bp. Deletion left flank: AAAAATTTGAATTTTTCGTGAAAATTTGAA. Deletion right flank: GCTCTCAATCTCTCATTGAAATAACGACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38E11.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26D10.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1371 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCTCTCTCCCCCTTTTCGT. External right primer: AATAGCTTCTGCACCGCCTA. Internal left primer: GTTTTCATGCACGGAAAGGT. Internal right primer: CCTCAACCCCTGGCATAATA. Internal WT amplicon: 2566 bp. Deletion size: 1225 bp. Deletion left flank: ACGCAACGTTCTTATCTTCGATCTTGGAGG. Deletion right flank: CCTTCAACCTTAAGCAGACCATTGAGGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3A.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C47E8.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1333 homozygotes (paralyzed Unc, mid- to late-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Previously known as daf-21. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

hdIs17 [glr-1::YFP + unc-47::YFP + unc-129::YFP + rol-6(su1006)]. hdIs10 [unc-129::CFP + glr-1::YFP + unc-47::DsRed + hsp-16::rol-6(su1006)]. Rollers. Reduced progeny at 25C (almost sterile). RNAi hypersensitive, effective RNAi in the nervous system. unc-47::DsRed is weak and only visible in adults. hsp-16::rol-6 transgene is not effectively Roll. Maintain at 15 or 20C.

Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7146 homozygotes), Dpy non-GFP mKate2+ sC1 homozygotes. Derived from parental strains VH7146 and CGC51. hd7146 is a 4918 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTTATTCCTGTATTTTTCAGTCATTACCT; Right flanking sequence: GCAATTTTTTGTATGATTTTTCATCAATTT. sgRNA #1: TGCATTATCGTCTGGGAAGC; sgRNA #2: AGAAAACCGATAAAATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

vkEx737 [hsp-4p::GFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.

nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61.

pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. pkIs2379 [hsp-16.41::I-Sce-I ORF + rol-6(su1006)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.

qxIs612 [hsp-16.2p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + hsp-16.41p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + unc-76(+)]. Heat-shock inducible NUC-1::sfGFP::mCherry fusion transgene for monitoring lysosomal activity. Array contains p76-16B, a plasmid containing 10.5 kb genomic DNA including unc-76. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5. doi: 10.1016/j.devcel.2019.10.020. PMID: 31735670.

qxIs750 [hsp-16.2p::nuc-1::pHTomato::unc-54 3'UTR + hsp-16.41p::nuc-1::pHTomato::unc-54 3'UTR + odr-1p::GFP]. Heat-shock inducible pHTomato transgene for monitoring lysosomal activity. Reference: Sun Y, et al. Elife. 2020 Jun 2:9:e55745. doi: 10.7554/eLife.55745. PMID: 32482227.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1021 [lin-31p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in P1.p-P11.p and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in P1.p-P11.p can mask GFP::HIS-58 signal. May carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1027 [unc-122p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in coelomocytes and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in coelomocytes can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi536 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::baf-1 + unc-119(+)] II. bqSi548 [dpy-7p::FLP + unc-119(+)] IV. Single-copy Dam::baf-1 and dpy-7p::FLP MosSCI transgenes for identifying DNA contacts of BAF-1 in hypodermal nuclei by DamID. Might still carry unc-119(ed3) or unc-119(ed9) in background. Reference: Romero-Bueno R, et al. EMBO J. 43(22): 5718-5746. doi: 10.1038/s44318-024-00261-8. PMID: 39367234.

bqSi777 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::baf-1(G12T) + unc-119(+)] II. bqSi548 [dpy-7p::FLP + unc-119(+)] IV. Single-copy Dam::baf-1(G12T) and dpy-7p::FLP MosSCI transgenes for identifying DNA contacts of BAF-1(G12T) in hypodermal nuclei in baf-1(G12T) mutant background by DamID. Reference: Romero-Bueno R, et al. EMBO J. 43(22): 5718-5746. doi: 10.1038/s44318-024-00261-8. PMID: 39367234.

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi997 [nhx-2p::FLP::SL2::mNG + unc-119(+)] IV. Single-copy GFP::Dam and nhx-2p::FLP MosSCI transgenes for identifying DNA contacts of BAF-1 in the intestine by DamID. Might still carry unc-119(ed3) or unc-119(ed9) in background. Reference: Romero-Bueno R, et al. EMBO J. 43(22): 5718-5746. doi: 10.1038/s44318-024-00261-8. PMID: 39367234.

bqSi1030 [hsp16.41p::FRT::mCherry::his-58::FRT::vhhGFP4::zif-1 + unc-119(+)] II. bqSi548 [dpy-7p::FLP + unc-119(+)] IV. Can be used for conditional depletion of GFP-tagged proteins in the hypodermis via anti-GFP nanobody fusion to ZIF1 (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Mechanism features heat-shock inactive ZIF-1 with FRT sites flanking inactivating sequence and hypodermal-specific expression of Cre to remove inactivating sequences to free vhhGFP4::zif-1 GFP degradation. May carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi1103 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::hpl-1 + unc-119(+)] II. bqSi997 [nhx-2p::FLP::SL2::mNG + unc-119(+)] IV. Single-copy Dam::hpl-1 and nhx-2p::FLP MosSCI transgenes for HPL-1 DamID in intestine. Might still carry unc-119(ed3) or unc-119(ed9) in background. Reference: Romero-Bueno R, et al. EMBO J. 43(22): 5718-5746. doi: 10.1038/s44318-024-00261-8. PMID: 39367234.

bqSi1104 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::hpl-2 + unc-119(+)] II. bqSi997 [nhx-2p::FLP::SL2::mNG + unc-119(+)] IV. Single-copy Dam::hpl-2 and nhx-2p::FLP MosSCI transgenes for HPL-2 DamID in intestine. Might still carry unc-119(ed3) or unc-119(ed9) in background. Reference: Romero-Bueno R, et al. EMBO J. 43(22): 5718-5746. doi: 10.1038/s44318-024-00261-8. PMID: 39367234.

bqSi1030 [hsp16.41p::FRT::mCherry::his-58::FRT::vhhGFP4::zif-1 + unc-119(+)] II. bqSi508 [elt-2p::FLP + unc-119(+)] IV. Can be used for conditional depletion of GFP-tagged proteins in the intestine via anti-GFP nanobody fusion to ZIF1 (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Mechanism features heat-shock inactive ZIF-1 with FRT sites flanking inactivating sequence and intestinal-specific expression of Cre to remove inactivating sequences to free vhhGFP4::zif-1 GFP degradation. May carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi1201 [hlh-12p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the distal tip cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the distal tip cells can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1308 [hlh-12p::FLP::SL2::mTagBFP2 + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the distal tip cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mTagBFP2 in the distal tip cells. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi1381 [dat-1p::FLP::SL2::mNG + unc-119(+)] V. Stable expression of FLP in dopaminergic neurons. Heat shock induces GFP expression in nuclei of dopaminergic neurons and red nuclei elsewhere. Constitutive expression of diffusible mNeonGreen in dopaminergic neurons can mask GFP::HIS-58 signal. Might still carry unc-119(ed3) or unc-119(ed9) in background. Reference: Fragoso-Luna A, et al. Genetics. 223(1). doi: 10.1093/genetics/iyac166. PMID: 36321973.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi1405 [hlh-12p::FLP::SL2::mTagBFP2 + unc-119(+)] V. Stable expression of FLP in distal tip cells. Heat shock induces nuclear GFP expression in the distal tip cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mTagBFP2 in the distal tip cells. Might still carry unc-119(ed3) or unc-119(ed9) in background. Reference: Fragoso-Luna A, et al. Genetics. 223(1). doi: 10.1093/genetics/iyac166. PMID: 36321973.

bqSi1411 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::rpb-6 + unc-119(+)] II. bqSi548 [dpy-7p::FLP + unc-119(+)] IV. Single-copy Dam::rpb-6 and dpy-7p::FLP MosSCI transgenes for for transcriptome analysis in hypodermal nuclei using RNA polymerase DamID. Might still carry unc-119(ed3) or unc-119(ed9) in background. Reference: Fragoso-Luna A, et al. Genetics. 223(1). doi: 10.1093/genetics/iyac166. PMID: 36321973.

bqSi1411 [hsp16.41p::FRT::mCh::his-58::FRT::dam::rpb-6 + unc-119(+)] II. bqSi997 [nhx-2p::FLP::SL2::mNG + unc-119(+)] IV. Single-copy Dam::rpb-6 and dpy-7p::FLP MosSCI transgenes for transcriptome analysis in hypodermal nuclei using RNA polymerase DamID. Might still carry unc-119(ed3) or unc-119(ed9) in background. Reference: Romero-Bueno R, et al. EMBO J. 43(22): 5718-5746. doi: 10.1038/s44318-024-00261-8. PMID: 39367234.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi453 [nhr-82p::FLP_CAI_G5D + unc-119(+)] IV. Heat shock produces green nuclei in the seam cell lineage and red nuclei elsewhere. Might still carry unc-119(ed3) III in background.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi487 [mec-7p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in mechanosensory neurons and red nuclei elsewhere.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi488 [tph-1p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in serotonin-producing neurons and red nuclei elsewhere.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi494 [hlh-8p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in the M lineage and red nuclei elsewhere.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. Heat shock produces green nuclei in body wall muscles and red nuclei elsewhere.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi506 [rgef-1p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in neurons and red nuclei elsewhere.