mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. Heterozygotes are wild-type with dim GFP signal in the pharynx. mIs11 homozygotes are wild-type with bright GFP in the pharynx. ieDf2 homozygotes (non-GFP) develop normally but produce 97.5% inviable embryos and a high frequency of males among the surviving self-progeny. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against. GFP expression in 4-cell embryos, pharyngeal muscle and gut. ieDf2 is a deficiency of zim-1, zim-2, zim-3, and him-8 generated by MosDel, resulting in single-copy insertion of a copy of the C. briggsae unc-119 gene on Chromosome IV. The deletion spans the sequences from the beginning of the zim-1 coding sequence through the ttTi22866 Mos1 insertion site.

bgIs312 [pes-6::GFP]. GFP expression in excretory cell only. Bus (resistant to infection by M. nematophilum and Leucobacter Verde2), hypersensitive to Leucobacter Verde1, bleach-sensitive, drug-sensitive; Him (high incidence of males). e2923 is a Mos1 insertion in bus-17 (ZK678.8). Reference: Yook & Hodgkin (2007), Genetics 175: 681-697

krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008

oxEx229 [Mos1 Substrate + myo-2::GFP]. Should be grown at 25C.

Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. Wild type worms with mCherry fluorescence in pharyngeal and body wall muscle. Visible on dissection microscope at high magnification. Complex transgene insertion in place of Mos1 allele ttTi5605. Useful for following "invisible" insertions at ttTi5605 site by Mos1 Single Copy gene Insertion (MosSCI). Please note: The insertion was a complex event pulling in more than one transgene and parts of the array. Therefore, the exact molecular structure of the insert is not known. Therefore the strain should NOT be used as a control for insert copy number or other detailed molecular controls of MosSCI insertions. Succesfully used as a balancer for the ttTi5605 locus.

Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).

Unc. MosSCI insertion strain with unc-18 marker instead of unc-119. Mos1 insertion in Chr I. Compatible with mosSCI targeting vectors pCFJ448 (Gateway) and pCFJ676 (MCS).

Unc. Not caused by cxTi10882. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). Grows best on HB101 bacteria. Reference: Frokjaer-Jensen C, et al., Nat Genet. 2008 Nov;40(11):1375-83.

DMPP resistant. Mos1 insertion.

Weakly resistant to 1mM levamisole in acute screen. Animals become paralyzed after >30 min but nose remains hypercontracted. Sluggish Unc. pka lev-10.

Mos1 transposon insertion in LG I. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR261 (Chr I 5'gaaatagagggcagttcaacg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.

Mos1 transposon insertion in LG X. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR266 (Chr X 5'gacaaagacgtgtagttgcg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.

hwSi3 [pie-1p::GFP::mex-3::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing full-length MEX-3 uniformly throughout oocytes and early embryos through the 4-cell stage. GFP::MEX-3 then mirrors endogenous MEX-3, disappearing from somatic cells by about the 12-cell stage. Also detected in P granules. GFP::MEX-3 can replace endogenous MEX-3. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

hwSi8 [pie-1p::GFP::mex-3(601-1248)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing a portion of MEX-3(601-1248) required for protein degradation. At about the 12-cell stage, soma-germline asymmetry is briefly visible before GFP::MEX-3(601-1248) becomes undetectable even in the germline blastomeres. Detected weakly on P granules only in the presence of endogenous MEX. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

hwSi13 [pie-1p::GFP::mex-3(2-636)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing truncated MEX-3 that is missing a portion required for protein degradation. GFP::MEX-3(2-636) is extraordinarily stable, persisting in somatic cells through the comma stage (~550 cells) at levels similar to those in 1- and 2-cell embryos. Also detected on P granules through hatching. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

Mos1 transposon insertion: F28F5 (at position 1023) acacctggtaCTCACCCCTGTTTAACACACAGTCTTCACA. Mos1 sequence is in lowercase.

Mos1 transposon insertion: T28A8 (at position 2841) acacctggtaTTAAGAAAAAAACCGAGTCCTCTCACCGTA. Mos1 sequence is in lowercase.

Mos1 transposon insertion: CO8D8 (at position 17534) acacctggtaATAAAAGAAGGAAAAATAAATATTTAAGTT. Mos1 sequence is in lowercase.

Mos1 transposon insertion: Y38C1AB (at position 8906) acacctggtaCAACTGGTTTAGAATAATTTAGAAATTACAA. Mos1 sequence is in lowercase.

Mos1 transposon insertion: F57F4 (at position 15459) acacctggtaGTCTCTTCAAGGAAGAACAATGAGAAATAA. Mos1 sequence is in lowercase.

Mos1 transposon insertion: frP6: F39H12 (at position 19268) acacctggtaAGCATAGGGCTAGGCCTTAGACTTTATATT, and frP7: Y10G11A (at position 1294) acacctggtaAAACAATTTCCAAGTAAAAAAATCATGTATT. Mos1 sequence is in lowercase.

Mos1 transposon insertion: frP8: H14A12 (at position 9047) acacctggtaTACAATTTTGATTTCAGAAAGTTCTCTGAC, and frP9: Y45F3A (at position 220) acacctggtaGAATTGTTCGAACAAGCTTCAACGAGAAAGCAA. Mos1 sequence is in lowercase.

Mos1 transposon insertion: B0272 (at position 11068) acacctggtaTATGAGAAAATCTATAGCAAGTACATATCT. Mos1 sequence is in lowercase.

Mos1 transposon insertions: frP11: F31C3 (at position 26364) acacctggtaTCGGAGGAGCTGCCAAATGGCGTCCGACTT. frP12: F01E11 (at position 3748) acacctggtaCAATCGAAAATCATTGAAATCAGTTAACAG. frP13: Y38E10A (at position 40384) acacctggtaTAGCTAGAGGACTGTCCCGGTCTAAAATGA. frP14: F53A2 (at position 34332) acacctggtaTATTATAAAAGATGTATGAAATGTCGTGAA. Mos1 sequence is in lowercase.

Mos1 transposon insertion: Y97E10B (at position 1022) acacctggtaAAACATGCTGAAAGTTTACTAAAATTGAAT. Mos1 sequence is in lowercase.

Mos1 transposon insertion: Y39A3CL (at position 24032) acacctggtaTATCGAAAAAAAATTTTTTTTTGGAATTTT. Mos1 sequence is in lowercase.

Mos1 transposon insertion: K07H8 (at position 8196) acacctggtaTTATCAAAGTTAGAATTCAAACTGCGTTGC. Mos1 sequence is in lowercase.

Mos1 transposon insertions: frP18: K03H4 (at position 19156) acacctggtaGAATGGATGAGGTTGAAAGTGACGAAGAAAA. frP19: F35H8 (at position 15891) acacctggtaGTTTACTCATATTTCTTTCCTCTCTTCTTC. frP20: T14B4 (at position 25648) acacctggtaTGCAAATATGGTTAATGTAAGGCATTTTTG. Mos1 sequence is in lowercase.

Dumpy. Mos1 transposon insertion: F30B5 (at position 22345) (dpy-13) acacctggtaGTTGTAGACGATTGGAAGAGTAATGCAAAC. Mos1 sequence is in lowercase.

oxEx229 [Mos1 Substrate + myo-2::GFP]. Pick GFP+ to maintain. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.

Mos1 insertion. Salt chemotaxis learning defective. Reference: Proc Natl Acad Sci U S A. 2011 May 3;108(18):7589-94.

Mos1 insertion in CBG13195 = Cbr-dpy-18 in exon before TATgtgagtcgatttgtttgatcgg. Dpy phenotype.

Mos1 insertion into coding region of K04C2.6 (med-2). No obvious phenotype.

jsSi1570 [delta_mosL::loxP::rpl-28::FRT::GFP::his-58::FRT3::mosR] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chromosome I. Derivative of jsTi1453 lacking the left mos1 arm.

Weak chemotaxis toward diacetyl. Possibly due to the weak chemotaxis toward diacetyl, qr1 were more preferentialy attracted by sodium acetate than WT in simultaneous two-spot presentation of sodium acetate and diacetyl. Mutagen used was Mos1 transposon, but it is not an insertion allele.

Weak chemotaxis toward low concentrations of sodium acetate. qr2 were more preferentialy attracted by diacetyl than WT in simultaneous two-spot presentation of sodium acetate and diacetyl. Mutagen used was Mos1 transposon, but it is not an insertion allele.

iaIs7 contains [nhr-57p::GFP + unc-119(+)]. ia61 was induced by Mos1 mutagenesis. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).