Search Strains

Hets are Muv and segregate Muv, dead eggs, and MuvBli. Maintain by picking Muv nonBli. Received new stock from Horvitz lab 10/97.

Double mutant is less sensitive to ionizing radiation than the parg-2(ok980) single mutant, but as sensitive as the exo-1(tm1842) single mutant. Parental parg-2(ok980) strain outcrossed 6 times; parental exo-1(tm1842) strain outcrossed 4 times. Reference: Bae W, et al. Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans. The FEBS Journal, In press.

Incompletely-penetrant exploding vulva. wd26 (E580K) is an intragenic revertant of the e262 allele for the backward movement phenotype; it is not known if it also modifies other e262 phenotypes. The wd26 lesion (E580K) is molecularly identical to wd14, wd16, wd17, wd18, etc. Reference: Pflugrad A, et al. Development. 1997 May;124(9):1699-709.

Unc. Reference: Winnier AR, et al. Genes Dev. 1999 Nov 1;13(21):2774-86.

Resistant to feeding dsRNA but sensitive to dsRNA injection.

F55H2.

Dyf. Osm. Throws males. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).

otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. Bright panneuronal nuclear GCaMP6s expression. Reference: Yemini E, et al. https://www.biorxiv.org/content/10.1101/676312v1

otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Bottlenecked 23x for isogenicity. Slow growing. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

GFP tag inserted into endogenous dmd-4 locus to create a C-terminal translational GFP fusion.

CRISPR-engineered deletion in dmd-4(ot935[dmd-4::GFP]) removing +3201 to +3710 relative to start codon. Partial removal of intron 3 results in loss of somatic nervous system expression without affecting pharyngeal expression.

otIs672 [rab-3::NLS::GCaMP6s + arrd-4::NLS::GCaMP6s]. otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.

otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.

otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.

otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.

otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.

wgIs418 [dmd-4::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

Endogenous dmd-4 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Stefanakis N, et al. Development. 2025 Jul 15;152(14):dev204622. doi: 10.1242/dev.204622. PMID: 40728647.

Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.

Heterozygotes are Unc and segregate Unc, dead eggs and UncLets. Lethal in larval development. Also reference 710.

alg-1(ap428 [alg-1::Y45F10D.4 3’UTR]) X. alg-1 control strain. ap428 is a CRISPR-engineered allele in which the endogenous alg-1 3'UTR was replaced by the Y45F10D.4 3'UTR. The Y45F10D.4 3'UTR was chosen because it appears to be stably expressed, is commonly used as a control gene in quantitative RT-PCR experiments, and its short 3’UTR lacks ALG-1 binding sites. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.

Y51A2D.4 Homozygous. Outer Left Sequence: aaggccgttttagtccgaat. Outer Right Sequence: tatttgtgcatgagcccgta. Inner Left Sequence: tttggatttccaggttctcg. Inner Right Sequence: atcaaagcctgctggaagac. Inner Primer PCR Length: 1151. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are WT. Segregates Lon males. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Homozygous viable. Deletion of 1616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCAACGTTGACCTTCAAAGCAGTAGCTTC ; Right flanking sequence: cggcagtttgctgcaacttattgcccaacc. sgRNA #3: TCCAATGCAGTTGCTTGAGT; sgRNA #4: acctcgtcgtttcagccaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTTCATTCAAGTTTTCTTACAGACTCAAA ; Right flanking sequence: TGGAGCATGCATTTCGCTCAACCCGAACTT. sgRNA #1: AAAATGTCGAAAGCCAACGT; sgRNA #2: GTATCGAAAATGGACGAGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10541 [dmd-4::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

stIs20032 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0.14 and 4.32 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

Heterozygotes are slow moving and fertile. stDf4 homozygotes move well and are sterile. st22 homozygotes are small and very sick. Pick slow moving animals and avoid well moving fertile recombinants.

GFP::3xFlag inserted into endogenous gld-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

GFP::3xFlag inserted into endogenous pid-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

3xFlag::GFP inserted into endogenous gld-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

Strain throws WT and Uncs. Maintain by picking WT.

WT PHENOTYPE.

Hypersensitive to UV and acute MMS treatment, not to X irradiation. Reduced X chromosome nondisjuction (partly suppresses some him mutations). Reduced brood size. Less than 25% of eggs hatch at 15C.

Animals with the Duplication are WT. Animals which have lost the Duplication are Unc. Throws males.

Animals heterozygous for yDp4 are Dpy non-Flu non-Unc. Animals which have lost yDp4 are FluUnc. Animals homozygous for yDp4 are dead (embryonic lethal). Low percentage of non-Dpy non-Unc progeny. These give a high percentage of Unc male self-progeny and are inferred to be yDp4 XO hermaphrodites.

Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.

B0035.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H22D14.1. External left primer: TGGGTTTTTAACGGGACGTA. External right primer: TTTTCCCTCACCTCATCCAG. Internal left primer: CGTTGCCATACATTCGAAGA. Internal right primer: CGTCTGCCTTCCAACTTTCT. Internal WT amplicon: 2278 bp. Deletion size: 974 bp. Deletion left flank: GTGCAGCGGTAACTCCAATATAATGCTCTC. Deletion right flank: AGGCTCGGCACACCCATTTCTTTTCTGTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H22D14.1. External left primer: TGGGTTTTTAACGGGACGTA. External right primer: TTTTCCCTCACCTCATCCAG. Internal left primer: CGTTGCCATACATTCGAAGA. Internal right primer: CGTCTGCCTTCCAACTTTCT. Internal WT amplicon: 2278 bp. Deletion size: 499 bp. Deletion left flank: TTCATTCATTGATTCAGCAAGTAGGGCATT. Deletion right flank: TACTTACAATCTTTGGACATTCCTGCTCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55H2.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 890 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: gcaatacaacgaagtcatctaaagtgttca. Right flanking sequence: tgtgtgtttttgagaggataaaaagaaaca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

C27C12.6. Deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon-2 males, WT males (ok1198 hemizygotes) and ok1198 homozygous hermaphrodites (arrest stage/phenotype undetermined - may be slow-growing viable). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 900 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAACAGATCTACACAATCCTGGAGCTCCT; Right flanking sequence: AGGCTCATTTTTGAAGCCGAATTTTACTAA. sgRNA #1: CACGAACATCTAGCTCCCTC; sgRNA #2: CTCCACTCGCCAAGGATAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Heterozygotes are WT (slightly Dpy) and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.

opIs219 contains [ced-4p::ced-4::GFP].

CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.