Hets are Muv and segregate Muv, dead eggs, and MuvBli. Maintain by picking Muv nonBli. Received new stock from Horvitz lab 10/97.

WT PHENOTYPE.

Heterozygotes are Blistered and Eat (terminal bulb relaxation defective). Heterozygotes segregate BliEat, BliEatUnc and dead eggs. ad695 previously called eat-12.

lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. Position of integrated transgene unknown (not on X). mir-35 family mutant expressing a mirtron-version of mir-35. nDf50 nDf49 mutants are partially rescued by expression of mirtron-35 from integrated transgene; mild mir-35-related phenotypes are more severe at elevated temperatures. Strain is derived from injection into parental strain MT14533. Position of integrated transgene unknown (not on X). Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

Deletion breakpoints are: GAGAGTCCCACACACGACTGGACTTCCA / TATCGAGCCA...AATGGCAGTCTA / CACGTTTTTCAACCAAATGCTATGGCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

mir-42, mir43 and mir-44 are deleted in nDf49. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Homozygous Emb deletion chromosome balanced by GFP and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nDf50 nDf49 homozygotes (arrest as late embryos). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Curr Bio (2010) 20:367-73.

nEx1187 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

nEx1188 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

nEx1189 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

Reference: Curr Bio (2010) 20:367-73.

mir-44, mir-61, and mir-247 are members of the mir-44 family. mir-45 is also part of this family, but is not deleted in thsi strain; it is closely linked to mir-44. Reference: Curr Bio (2010) 20:367-73.

mir-2 family and most of mir-44 family are removed in this strain (mir-45 is present). Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.

Heterozygotes are WT and segregate WT, Unc-36, dead eggs and zygotic embryonic lethals (nDf40 dpy-18 homozygotes). Maintain by picking WT.

Animals with ctDp6 are WT and throw WT and dead eggs.

Unc. nDf41 is homozygous lethal. Throws dead eggs.

Heterozygotes are Unc and segregate Uncs and dead eggs.

Heterozygotes are WT and segregate WT, DpyUncs and animals which arrest as L1 or L2 larvae (nDf43) homozygotes.

WT PHENOTYPE.

WT PHENOTYPE.

WT PHENOTYPE.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.