Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
FX30164 C. elegans tmC16 [unc-60(tm9712)] V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30233 C. elegans tmC16 [unc-60(tmIs1210)] V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
GS7638 C. elegans exc-6(gk386) cyk-1(or596) III; arIs198. Show Description
Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals.
GS7960 C. elegans exc-6(gk386) cyk-1(or596) III; inft-2(ok1296) V; arIs198. Show Description
Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals. Strain is quite sick even at the permissive temperature.
HBR1907 C. elegans goeIs410. Show Description
goeIs410 [hsp-16.2p::cnc-6::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-6::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
JIM356 C. elegans ujIs113 II; ujIs153. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs153 [ceh-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0622c06 by recombineering. Expression of transgene confirmed by GFP.
JJ1508 C. elegans unc-119(ed3) III; zuIs60. Show Description
zuIs60 [pie-1p::GFP(secreted) + unc-119(+)]. Maternally-expressed secreted GFP fills spaces between embryonic cells, and space between embryo and vitelline membrane. Useful marker for vizualizing intercellular spaces in embryos. Reference: Wehman AM, et al. Curr Biol. 2011 Dec 6;21(23):1951-9.
JM47 C. elegans ges-1(ca6) V. Show Description
Phenotypically WT. Isoelectric variant of ges-1 intestinal carboxylesterase.
JR2750 C. elegans bli-6(sc16) unc-22(e66)/unc-24(e138) vha-17(w13) dpy-20(e2017) IV. Show Description
Pick wild type animals to maintain.
KJ487 C. elegans vha-8(jh135)/bli-6(sc16) egl-19(ad695) unc-24(e318) IV. Show Description
Heterozygotes are WT and segregate WT, Bli Unc, and dead larva. vha-8(jh135) homozygotes are larval lethal.
LE3091 C. elegans juIs76 II; unc-6(e78) X. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.
MJ66 C. elegans emb-7(hc66) III. Show Description
Temperature sensitive egg lethal. Maintain at 15C. Will grow at 20C, and a few leak through at 25.4C.
ML2550 C.elegans git-1(mc86[git-1::histag::2xpreCissionCleavageSite::gfp) X. Show Description
Superficially wild-type. Reference: Vuong-Brender TTK, et al. Development 2017 : doi: 10.1242/dev.150383
ML855 C. elegans +/szT1 [lon-2(e678)] I; ppk-3(mc46)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon males, mc46 hemizygotes (WT males) and mc46 homozygotes. mc46 is a deletion that results in homozygotes which show enlarged vacuoles (late endosomes and lysosomes) and lay eggs with enlarged vacuoles that die at different stages of embyronic development.
MLC349 C. elegans ttTi5606 II; unc-119(ed3) III; mir-1820(luc16[unc-119(+)]) IV. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-1820 deletion allele; miRNA hairpin replaced by unc-119.
MLC56 C. elegans lucEx43. Show Description
lucEx43 [mir-791(fosmid)::GFP + ttx-3p::mCherry]. Pick mCherry+ to maintain. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
MP140 C. elegans enu-2(lb140) III. Show Description
Mildly Unc. Adults display progressive vacuolization of body wall muscle. Neither phenotype is suppressed by mec-6(e1342).
MP84 C. elegans dpy-5(e61) mec-6(lb84) I; unc-8(n491) IV. Show Description
Dpy.
MT468 C. elegans dpy-7(e88) unc-6(n102) X. Show Description
Dpy. Unc. Retains eggs.
MT5240 C. elegans unc-5(e53) lin-33(n1043) bli-6(sc16) IV. Show Description
Unc. Vul. Blistered.
MT5242 C. elegans unc-5(e53) bli-6(sc16) IV. Show Description
Blistered Unc.
MT7620 C. elegans lin-45(n2506) unc-24(e138)/bli-6(sc16) unc-24(e138) IV. Show Description
Heterozygotes are Unc and segregate Unc, UncVul, and BliUnc.
NFB1720 C. elegans tph-1(vlc46[tph-1::T2A::mNeonGreen]) II. Show Description
mNeonGreen tag inserted into endogenous tph-1 locus. Upstream flanking sequence: CTCTCCGCTCAGACATCAACCTGCTCGCCGGAGCTCTCCACTACATCCTG. Downstream flanking sequence: TAGTTTGAGTTTCCGTGTTTTTTATTTTTTTTATTTGGTTTCTGCTTTCT. Guide sequence: GTAGTTTGAGTTTCCGTGTT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NJ833 C. elegans exc-6(rh103) III. Show Description
Excretory canal defect. Canal varies in length from no outgrowth to almost complete outgrowth. Frequent small vacuoles and extra branchings in the canal lumen visible only by Nomarski microscopy. Animals are somewhat pale.
NK2631 C.elegans qySi99 I; unc-6(ev400) X. Show Description
qySi99 [lin-29p::fdgt-1::mNG + loxP] I. Unc. Single-copy insertion. unc-6 mutant expressing anchor cell specific fdgt-1 glucose transporter. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell 2022 March 21. https://doi.org/10.1016/j.devcel.2022.02.019
NK2794 C.elegans fdgt-1(qy65[fdgt-1::mNG + loxP]) II; unc-6(ev400) X. Show Description
mNG tag inserted into the endogenous fdgt-1 locus. Unc. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK2936 C. elegans unc-6(cp190[unc-6::mNG::3xFLAG + LoxP]) X. Show Description
mNG and 3xFlag tags inserted into the endogenous unc-6 locus. Superficially wild-type. Reference: Naegeli KM, et al. Dev Cell. 2017 Nov 20;43(4):403-417.e10. doi: 10.1016/j.devcel.2017.10.024. PMID: 29161591
NK2943 C. elegans hmgr-1(qy202[mNG::hmgr-1]) III; unc-6(ev400) X. Show Description
hmgr-1 locus endogenously tagged with mNG at the N-terminus in unc-6 mutant background. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2966 C. elegans qySi205 I; unc-6(ev400) X. Show Description
qySi205 [lin-29p::icmt-1::mScarlet] I. unc-6 mutant expressing anchor cell specific prenylation enzyme icmt-1. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK3211 C. elegans nuo-1(qy145[nuo-1::mNG]) II; emb-9(qy244[emb-9::mRuby2]) III; unc-6(ev400) X. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. mRuby2 tag inserted into C-terminus of endogenous emb-9 locus. Unc-6 netrin mutation causes reduced movement and protruding vulva (Pvl) phenotype.
NK3255 C. elegans mtx-2(qy248[mNG::mtx-2]) III; unc-6(ev400) X. Show Description
mNeonGreen tag inserted into N-terminus of endogenous mtx-2 locus in netrin null mutant background (ev400).
NK3281 C. elegans unc-119(ed4) III; unc-6(ev400) X; qyIs552. Show Description
qyIs552 [lin-29p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of ratiometric ATP:ADP biosensor PercevalHR. netrin null mutant background (ev400).
NK3306 C. elegans unc-119(ed4) III; unc-6(ev400) X; qyIs636. Show Description
qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP in netrin null mutant background (ev400).
NK564 C. elegans unc-119(ed4) III; qyEx78. Show Description
qyEx78 [Venus::unc-6(deltaSP) + unc-119(+)]. Maintain by picking non-Unc.
NW434 C. elegans unc-6(ev400) X. Show Description
Unc.
OD9 C. elegans unc-119(ed3) III; ltIs5. Show Description
ltIs5 [(pIC36) pie-1p::kbp-1::GFP::TEV-STag + unc-119(+)].
OH14431 C. elegans otIs638. Show Description
otIs638 [unc-6(fosmid)::NLS::YFP::H2B + ttx-3p::mCherry + pha-1(+)]. Integrated fosmid reporter for unc-6. Reference: Weinberg P, et al. Curr Biol. 2018 Feb 19;28(4):623-629.e3.
OH14543 C. elegans pha-1(e2123) III; otEx6799. Show Description
otEx6799 [gab-1(fosmid)::SL2::NLS::YFP::H2B + ttx-3::mChopti + pha-1(+)]. Maintain at 25C to select for array. Reporter tag inserted into fosmid WRM0640aC06. Line 2-3. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14544 C. elegans pha-1(e2123) III; otEx6800. Show Description
otEx6800 [lgc-37(fosmid)::SL2::NLS::YFP::H2B + ttx-3::mChopti + pha-1(+)]. Maintain at 25C to select for array. Reporter tag inserted into fosmid WRM0640aC06. Line 3-2. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH18398 C. elegans otIs669 him-5(e1490) V; unc-6(syb5064[unc-6::SL2::GFP::H2B]) X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
OH18863 C. elegans unc-18(ot1432(unc-18::SL2::GFP::H2B)) X. Show Description
Endogenous reporter generated by the insertion of SL2::GFP::H2B into the endogenous unc-18 locus. Expression in intestine and nervous system. Reference: Boeglin M, et al. Genetics. 2023 Dec 6;225(4):iyad180. doi: 10.1093/genetics/iyad180. PMID: 37793339.
OP667 C. elegans unc-119(tm4063) III; wgIs667. Show Description
wgIs667 [dhhc-6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
RB1450 C. elegans csp-3(ok1653) I. Show Description
Y47H9C.6. Homozygous. Outer Left Sequence: GGAATCGGAATTGGAACTCA. Outer Right Sequence: CTTCATCGCCACTCACTCAA. Inner Left Sequence: TAATTTCAGCCAATTTGCCC. Inner Right Sequence: CAAACGCCACTGGATTCTCT. Inner Primer PCR Length: 2153 bp. Deletion Size: 1249 bp. Deletion left flank: TCTTTTGAGAGAGCCAATAAGTTTTATTTT. Deletion right flank: TCCGCTTGCGACGACGAGGTTTGGTGTGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB859 C. elegans Y57A10C.6(ok693) II. Show Description
Y57A10C.6. Homozygous. Outer Left Sequence: AAGTTTGGTTGCCCAGTGAA. Outer Right Sequence: CCTGGCTACGTAGTTCCCAA. Inner Left Sequence: ACTTTTCCGATTTTCCGGTT. Inner Right Sequence: TCGTTGGAGTCGGTATGACA. Inner primer WT PCR product: 2202. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3420 C. elegans Y48G1C.6(ve920[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1281 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATCAGAATCTGATTCGTGGCCGTTTTCCT ; Right flanking sequence: TGGAGACAGCAAATTGGCACACACGCAGAG. Y48G1C.6 sgRNA A: CCGCCAGAACTTTAGGAACT; Y48G1C.6 sgRNA B: GAACGAAGGGGCAAGACTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5002 C. elegans +/mT1 [umnIs52] II; psd-1(gk5580[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5580 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4509 and CGC66. gk5580 is a 6731 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACAAGCTCGACACTTGCCACGTGGACTAA. Right flanking sequence: TCTGGCGGACCGAAGAACGTTGAAAAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5031 C. elegans +/mT1 [umnIs52] II; tftc-5(gk5467[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5467 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4389 and CGC66. gk5467 is a 2935 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTCGTATTATGGCGGAACGGAAACCTCAG; Right flanking sequence: GCAATGAATGAGCTAGTGGCTGTTGTAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5032 C. elegans +/mT1 [umnIs52] II; C14B9.10(gk5476[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5476 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4398 and CGC66. gk5476 is a 1853 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACCAAACCGTCAGACATGCTGCGTCTCCT; Right flanking sequence: AACTGGCAAGAAATGGTTCCGCATTGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5033 C. elegans +/mT1 [umnIs52] II; F45G2.10(gk5482[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5482 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4404 and CGC66. gk5482 is a 2468 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTAAACACGTTTTTATTCGAAACCTGAT. Right flanking sequence: GCTGGAAATGGAAAATGACGAAAAAATATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5034 C. elegans +/mT1 [umnIs52] II; mrps-18C(gk5520[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5520 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4445 and CGC66. gk5520 is a 1322 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGGTCGCAGAAGAACATTGACCCCAGCTC; Right flanking sequence: GAAGAGATAAAACGAAAGCTAAGATTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.