Search Strains

More Fields
Strain Species Genotype Add
NW1701 C. elegans mab-20(ev778) I; muIs32 II; him-5(e1490) V. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Extensive ray fusion. Body morphology defects at larval stages. Embryonic and larval lethality.
NWG285 C. elegans lgl-1(crk66[lgl-1::GFP]) X. Show Description
GFP tag inserted into endgonenous lgl-1 locus. LGL-1::GFP expressed throughout the worm at all developmental stages. Reference: Rodrigues NTL, et al. Development. 2022 Jul 15;149(14):dev200545. PMID: 35713287
OC188 C. elegans zyg-1(it25) szy-16(bs36) II. Show Description
it24 is temperature sensitive; produces maternal effect embryonic lethal phenotype (Mel) after shoft to 24C at L4 stage. Mel is partially suppressed by bs36 at 24C. Reference: Kemp C, et al. (2007) Genetics 176:95-113.
OC199 C. elegans zyg-1(it25) sds-22(bs9) II. Show Description
it24 is temperature sensitive; produces maternal effect embryonic lethal phenotype (Mel) after shift to 24C at L4 stage. Mel is partially suppressed by bs9 at 24C. sds-22 previously called szy-6. Reference: Kemp C, et al. (2007) Genetics 176:95-113.
OC204 C. elegans zyg-1(it25) dpl-1(bs21) II. Show Description
it24 is temperature sensitive; produces maternal effect embryonic lethal phenotype (Mel) after shoft to 24C at L4 stage. Mel is partially suppressed by bs21 at 24C. szy-10(bs21) has a partially penetrant embryonic lethal phenotype at all temperatures. Reference: Kemp C, et al. (2007) Genetics 176:95-113.
OH11744 C. elegans otIs445; gwIs39. Show Description
otis445 [ace-2p::RFP + LacO repeats]. gwIs39 [baf-1p::GFP::lacI::let-858 3'UTR + vit-5p::GFP]. RFP expression in cholinergic motor neurons. LACI::GFP aggregates on LacO repeats to form two dots in every nucleus. vit-5::GFP is expressed in intestine at L4 stage and later. Reference: Patel T & Hobert O. eLife 2017.
OH12050 C. elegans otEx5449. Show Description
otEx5449 [fozi-1(fosmid)::YFP + che-1p::mCherry]. otEx5449 is a complex array derived from injection with PvuII-digested E. coli genomic DNA. Onset of fozi-1::YFP expression is around 3-fold stage in embryos. Pick animals with che-1p::mCherry exprssion in ASE neurons to maintain.
OH14711 C. elegans nhr-67(ot795) IV; him-5(e1490) V; otEx5999. Show Description
otEx5999 [nhr-67(fosmid) + unc-47p::mChopti]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx5999 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14712 C. elegans nhr-67(ot795) IV; him-5(e1490) V; otEx6001. Show Description
otEx6001 [nhr-67(fosmid) + unc-47p::GFP]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx6001 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH19186 C. elegans cone-1(ot1502[GFP::H2B::SL2::cone-1]) III. Show Description
GFP::H2B tag with SL2 inserted at N-terminus of endogenous cone-1 locus. Ubiquitous nuclear green at all stages (as early as 2-cell). GFP signal is very bright compared to C-terminal tag in OH19215. Please contact Oliver Hobert prior to publishing work using this strain.
OH19215 C. elegans cone-1(ot1514[cone-1::SL2::GFP::H2B]) III. Show Description
CRISPR reporter, substitution of SL2 for T2A. A broad nuclear expression begins around the Comma stage. Brighter expression with earlier initiation than T2A reporter. Expression becomes restricted to non-neuronal cells as animals mature to larval stages. Please contact Oliver Hobert prior to publishing work using this strain.
OH8882 C. elegans otEx3909. Show Description
otEx3909 [ceh-36(fosmid)::YFP + rol-6(su1006)]. otEx3909 is a complex array derived from injection with PvuII-digested E. coli genomic DNA. ceh-36::YFP is broadly expressed in early stage embryos and becomes restricted to ASE and AWC later in development. Pick rollers to maintain.
PD2620 C. elegans ccDf2620/unc-54(e1152) I. Show Description
Heterozygotes are wild-type and should segregate wild-type (ccDf2620/unc-54(e1152) heterozygotes), Unc (unc-54(e1152) homozygotes), and ccDf2620 homozygotes (larval arrest around L1 stage). Maintain by picking heterozygotes and checking for proper segregation of progeny. ccDf2620 removes the rDNA repeats at the end of chromosome I. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PD8662 C. elegans lin-31(n301) hlh-1(cc450)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc (mnC1 homozygotes) and larval lethals (lin-31 hlh-1 homozygotes). The lin-31 hlh-1 homozygotes are very Dpy and Lumpy and look like they hatched just after reaching the two-fold stage. See also WBPaper00001975.
PE873 C. elegans feIs5 X; dvIs14. Show Description
feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. Rollers. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PHX1856 C. elegans cfi-1(syb1856[cfi-1(mut_COE)::mNG::AID*) I. Show Description
Eight COE motifs in A4e were mutated in endogenously-tagged cfi-1(kas16[mNG::AID*::cfi-1]). Expression of cfi-1::mNG::AID* is down-regulated in late larval stages and adults. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.
PHX3293 C. elegans bli-2(syb3293[bli-2::mNG]) II. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-2 locus. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
PHX7380 C. elegans cone-1(syb7380[wrmScarlet::cone-1]) III. Show Description
Broad puncate expression in non-neuronal cells, later expression initiatiated ~1.5-2 fold stage. wrmScarlet tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PJ1115 C. elegans gaIs37 IV; ccIs55 V. Show Description
gaIs37 [Ef1a::Dmek hs::mpk-1] IV. ccIs55 [unc-54::lacZ + sup-7(st5)] V. At 20C, 99% of the worms are WT. At 25C, close to 100% of the worms are Muv. Also, a heat-shock at the L2 stage can produce a 80-90% Muv phenotype.
PS3239 C. elegans dpy-20(e1282) syIs49 IV. Show Description
syIs49 [zmp-1::GFP + (pMH86) dpy-20(+)] IV. Non-Dpy. Expresses GFP in anchor cell at L3 stage. VulA at late L4, and VulE soon thereafter. Do not distribute this strain; other labs should request it from the CGC.
PS3351 C. elegans dpy-20(e1282) syIs17 IV. Show Description
syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)] IV. Non-Dpy animals which at all stages progressively exhibit Go(gf) phenotype after heat shock treatment (standard treatment is 33C water bath for 30 minutes). Animals cease feeding, foraging, locomotion, ovulating and egg laying. Gravid adults eventually bag. "Suicides" are common. Do not distribute this strain; other labs should request it from the CGC.
PS3747 C. elegans ipp-5(sy605) X; syEx429. Show Description
syEx429 [ipp-5p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Construct pIP5 contains 2.0 kb promoter fragment upstream of ipp-1 driving GFP expression in distal spermatheca (in adults); pharynx and vulva (all stages). [NOTE: the syEx429 array in this strain was previously incorrectly annotated as carrying ipp-1p::GFP. The array contains an ipp-5p::GFP transgene.]
QQ251 C. elegans vab-9(ju6) II; mcIs50. Show Description
mcIs50 [lin-26p::vab-10(actin-binding domain)::GFP + myo-2p::GFP + pBluescript]. Variably Abnormal with body shape defects and bobbed tail at all stages. Reference: Vuong-Brender TTK, et al. PLoS One. 2018 Feb 21;13(2):e0193279.
QQ258 C. elegans vab-9(ju6) II. Show Description
Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen). Reference: Simske JS, et al. Nat Cell Biol. 2003 Jul;5(7):619-25.
RA332 C. elegans unc-119(ed3) III; rdIs24. Show Description
rdIs24 [F12E12.5::GFP + unc-119(+)]. Spontaneous integrant of UL1189. Expresses GFP in somatic gonad during L2-L3 stages. Reference: Large EE, Mathies LD. Dev Biol. 2010 Mar 1;339(1):51-64.
RA446 C. elegans unc-119(ed3) III; rdIs4 X. Show Description
rdIs4 [ehn-3a::Venus + unc-119(+)] X. Expresses Venus (YFP) in Z1/Z4 beginning in embryogenesis and continuing through the L1 larval stage. Reference: Large EE and Mathies LD. G3 (Bethesda). 2014 Mar 20;4(3):471-83.
RB1217 C. elegans F25G6.2(ok1233) V/nT1 [qIs51] (IV;V). Show Description
F25G6.2 Heterozygotes are WT and GFP+ in the pharynx. ok1233 homozygotes arrest at the L1 stage. Outer Left Sequence: TGAACTCACGAAAATGACGG. Outer Right Sequence: ATACAGGTTCCAATGAGCGG. Inner Left Sequence: CTCGGTGCACGAAGTGTAAA. Inner Right Sequence: GCCAAAAAGGAATTGCAAAA. Inner Primer PCR Length: 3056. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1277 C. elegans gcy-6(ok1293) V/nT1 [qIs51] (IV;V). Show Description
B0024.6 Heterozygotes are WT and GFP+. ok1293 animals arrest in the larval stage. Outer Left Sequence: agggagagggataaggggtt. Outer Right Sequence: tgcaatgccagttttcattc. Inner Left Sequence: gtccgccaaggatttaacaa. Inner Right Sequence: gggggataacttcatcagca. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3044 C. elegans +/mT1[umnIs52] II; rpn-3(ve544[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous arrest at larval stage. Deletion of 1779 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (ve544 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: ttcaaattttaaagggaaATGGCTCCGAAA ; Right flanking sequence: ccgaatgaattttataaggatgaattgcat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3057 C. elegans mrpl-41(ve557[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ II. Show Description
Unbalanced heterozygote. Homozygous lethal, arrests at late larval stage with a few escapers that become sterile adults. Pick viable fertile GFP+ animals to maintain. Deletion of 1032 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: ACTGGTGCTCGTAAGCACTCGTGGAGTCCG ; Right flanking sequence: TGTTCAAATCGAAAAGCGACGAGTTGCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3068 C. elegans C25A1.16(ve568[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous Lvl. Deletion of 477 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve568 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TTTCACCCCCAATAAACCTATCAATTATCA ; Right flanking sequence: tcaggtttaaattagatttcttcgaatttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3085 C. elegans mrpl-34(ve585[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve585 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ttatcaaactctcatttttagATGCCATCG ; Right flanking sequence: GTCGGCGACGGAATATATTCTTCAAAATCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3104 C. elegans cwc-15(ve604[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous larval arrest. Deletion of 1421 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear young larvae easiest to see at the edge of the lawn (ve604 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aactcatattcaaaactcgcgccgaaatgt ; Right flanking sequence: gtaggccgtatcgacttttcaagtactttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3161 C. elegans Y53G8AR.6(ve661[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26]III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Homozygotes are unhealthy. Deletion of 1671 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) unhealthy animals (ve661 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aaaaatccgctagaaaccgtctaaaaacct ; Right flanking sequence: AGGCTTCACGTGCTGAAAGATTCGGAATTA. sgRNA #1: atcaatagcgtaggctttac; sgRNA #2: ACTAACATCAAATGACGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3239 C. elegans trmt-6(ve739[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. ZK858.7. Homozygous lethal. Deletion of 2453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 lethals(lethal mid-larval to adult) (ve739 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation in hT2 is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: catattattaaattttaagtgtaaaagatt ; Right flanking sequence: aggcaacagagaacgaacgataaagtagtc. sgRNA #1: gaggaaatatgcaatttact; sgRNA #2: atcgacgagacggctacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3263 C. elegans F15D3.6(ve763[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 1689 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve763 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: gaaatcagtgatcaggcaacagacaacagc ; Right flanking sequence: cggaaatcgcgatggcgaagcacacaaaaa. sgRNA #1: tgatgtgaaccagagaaagc; sgRNA #2: ggtaaaagtctgcggaatga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3269 C. elegans F10G8.9(ve769[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous sterile. Deletion of 2540 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve769 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: atgaaattaaaaataaataaaaattttgag ; Right flanking sequence: ATTTGTAATTCATTTGGATTCGGTGCCACA. sgRNA #1: ATGCACCGTGTTGTTATAAC; sgRNA #2: TGAGATTCGCGATTTATTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3284 C. elegans eif-3.C(ve784[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Homozygous early larval lethal. Deletion of 2440 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve784 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTCTGCTGAGCATACGACGACGCATTTCG ; Right flanking sequence: ttaaataataatttattatttaatcacaat. sgRNA #1: AATTCGCAACTAGCCATGTG; sgRNA #2: atctccgcgcaaatgcccac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3311 C. elegans fars-2(ve811[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous Ste, Pvl, Unc. Deletion of 3213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ Ste, Pvl, and Unc animals (ve811 homozygotes) and arrested non-GFP (stage unknown, some uncharacterized non-GFP hermaphrodites develop into fertile adults) (sC4 homozygotes). Maintain by picking wild-type dim GFP+. Left flanking Sequence: ggtttttcagtgctcttcgtattacCTCCT ; Right flanking sequence: TTCGTCTTTCGAGTAGAGCCGAACACCTTC. sgRNA #3: TGAAAGAGCACTTACCAAGG; sgRNA #4: CTACTCGGCAAAAAGCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3316 C. elegans lrp-1(ve816[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest, Mlt. Deletion of 15775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve816 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTGGTTGTCAAGCAGGTTGCCATCCATCA ; Right flanking sequence: CACGTCAGCATCTGCAATGTCACCAAACAG. sgRNA #1: CACGTACATTCACCTCCATG; sgRNA #2: GATGGCTGATCATTTGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3327 C. elegans T06E6.1(ve827[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous early larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+  arrested larvae (ve827 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+.  Left flanking Sequence: CGTCGGATGATTTTTTCGCCCTTTTCACCG; Right flanking sequence: AGGTAATCTCATCGCTTTTCGGGTCAAGGG. T06E6.1 sgRNA #1: CGTGTGGGGAGTGATGGAAC; T06E6.1 sgRNA #2: CTCGTCATTCCAGATCATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3355 C. elegans rpl-38(ve855[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous sterile. Deletion of 5417 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+  sterile (ve855 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type dim GFP+. May grow better at 15C. Left flanking Sequence: GGCTTCAACTATATTTTAATTTTTCAGGTA; Right flanking sequence: GCTCAAGTAGATCAAATCTCTTCTCTGCTC. rpl-38 sgRNA #1: ATCCACCATTGCGATGCCAA; rpl-38 sgRNA #2: TCCTTGACTTGGATGCCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3363 C. elegans nsun-4(ve863[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 5392 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae, some larva mature into sterile dumpyish adults (ve863 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: AAAGAAATGGCCAAGTATTCGGCTGGGCCT; Right flanking sequence: CTAACTTTGGACCAATGTATATTTGCAAAC. nsun-4 sgRNA #1: AATATCGATTCGGAGACAGA; nsun-4 sgRNA #2: AGGGTAGAAACGGCACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3385 C. elegans plag-15(ve885[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous Mel. Deletion of 1641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that give dead eggs (ve885 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TGGAGGGAGAAGATTGAGCTCATAGTGGAG; Right flanking sequence: TGGCAATTCTTAAACATCCAAATGCAATTG. plag-15 sgRNA A: CCTCCATCATCATACCCGAC; plag-15 sgRNA B: AGTATTTCAAGCTGATCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3438 C. elegans let-767(ve938[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval lethal. Deletion of 1104 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) early larval lethal (ve938 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: ATCCATGAGCTCGAGTTGAAGTTGATGCGT; Right flanking sequence: TGGAATTTACAGAATTTCAATGGAAATAAC. let-767 sgRNA A: GATGTATCCGGTGGTGTCTG; let-767nsgRNA B: CACTGGCAAGCCATGTTACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3440 C. elegans rnp-7(ve940[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III.  Maintain by picking GFP+ Rollers (GFP expression in both pharynx and distal tip cells). Heterozygotes are Rol GFP+ (GFP expression in both pharynx and distal tip cells), and segregate Rol GFP+ (GFP expression in both pharynx and distal tip cells), non-Rol GFP+ (GFP only in pharynx) ve940 homozygotes (Unc, arrest as larvae with a curled tail). qC1[qIs26] is homozygous lethal (unknown stage). Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCTTCGATATCCACCACCGGATCCTCCA; Right flanking sequence: TGGAAGATATTGCACTGGTGGTCGTGCTTC. rnp-7 sgRNA A: GGAAGCCGATACAGTACAGG; rnp-7 sgRNA B: ACTAGTAGGTCCTGGCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3441 C. elegans arx-6(ve941[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III.  Sterile. Deletion of 651 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) grotty adults with vulval blip (ve941 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: GCGTCACACGCTCCAGGCAGCTCTCTGTCT; Right flanking sequence: GAATTTTTGAAGCGTTTCAATTAAttttct. arx-6 sgRNA A: TGAGCAATTCAGTTCGCAGG; arx-6 sgRNA B: TTCAGCAGAAACACGGGCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3478 C. elegans let-805(ve978[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III.  Emb. Deletion of 22058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), dead embryos (ve978 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aggtagaaaaaatgtagactagccccccct; Right flanking sequence: tcgttttccaaattaatcagaaattagcat. let-805 sgRNA #1: tgagtcagcagaggccgggg; let-805 sgRNA B: attacGTTGGGTTGCAGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3493 C. elegans rars-1(ve993[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval arrest. Deletion of 2015 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve993 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Note: this strain exhibits ectopic body wall GFP expression. Left flanking Sequence: aaggctcgacatgtaattacacacatacCT; Right flanking sequence: AGGGGAACATCAAGTCCAGGGAATGCATCT. rars-1 crRNA A: GTTATTGAAAATAAGGAAGG; rars-1 crRNA B: TTGGAGTTTCAGCGAGGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3502 C. elegans madf-11(ve1002[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Mel. Deletion of 2623 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) adults that give progeny that die early (ve1002 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: AAAGTTAAATATTGATGTTGAAGTTTGCCT; Right flanking sequence: ATTTTTAATAATAATTCTGAAATTTATTTT. madf-11 crRNA A: GTTCCCATTGAAAAATCACC; madf-11 crRNA B: TTCCAATGAGCGACCGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.