RG3057 |
C. elegans |
mrpl-41(ve557[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ II. Show Description
Unbalanced heterozygote. Homozygous lethal, arrests at late larval stage with a few escapers that become sterile adults. Pick viable fertile GFP+ animals to maintain. Deletion of 1032 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: ACTGGTGCTCGTAAGCACTCGTGGAGTCCG ; Right flanking sequence: TGTTCAAATCGAAAAGCGACGAGTTGCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|