bafIs63 [lin-42p(mut)::GFP + unc-119(+)]. lin-42p(mut)::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+); all potential DAF-12 binding sites have been mutated. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.

Mutator.

Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer.

Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. Molecular null, deletion removes promoter region. Homozygous viable and fertile, fecundity reduced by approximately 30%. nid-1=F54F3.1.

Nose touch defective (recessive). Mechanosensory defective (semi-dominant). Mildly Dpy (ts).

WT phenotype. May still carry mut-4(st700).

WT movement and body wall muscle.

Unc.

Non-Twitchers. Still contains Tc1. Temperature sensitive. Sterile at 25C, grows ok at 20C. Dauer larvae are SDS resistant.

Him. Mutator. RNAi-defective. Temperature-sensitive sterile at 25C. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.

mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.

RNAi-deficient in soma. Reference: Zhang C, et al. Proc Natl Acad Sci U S A. 2011 Jan 25;108(4):1201-8.

meGFP tag inserted at C-terminus of endogenous mut-16 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."

Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Derived by outcrossing JK3826 to remove mut-16 deletion. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.

qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. teIs1 [oma-1::GFP + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.

qbcSi10 [mex-5p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.

qbcSi112 [elt-2p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.

Very mildly Dpy Tc1-induced dpy-19 allele. Generates severe Dpys when Tc1 hops out of dpy-19 (doesn't excise cleanly). See also WBPaper00001672. [Some concern whether the Mut phenotype in this strain is actually mut-2 because it showed no transposition of Tc3 or other Tc's besides Tc1. 1/95.]

Insertion in CCTTCAGAAG TA TGTCATTTGG.

Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator.

Mutator.

Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA.

Mut. RNAiR.

TTTAAAACG TA CTTACCTTT

insertion: TTCTGTGAAC TA TGTCAAAAT

Dpyish.

Insertion in GGTCAAACG TA AGTTAAAGT.

Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat. AKA mut-8.Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat.Mutator.

glc-2(pk55) previously called avm-2(pk55).

TTCTCACA TA ATTCCGATCT. Somewhat Dpyish.

K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.

F40E10.2. Location of the insertion: ATTAATAATA TA ACTATTGAAA.

F55H2.

T17E9.1

K08A8.1 Previously called kin-17(pk97).

Dpyish. Primers used to isolate pk209 are: cgatcctcgacagtttgaactgc & cgagattcagggcatgtctatgc.

Mutator strain. Throws males. See WBG 14(2): 24. Strain has a ts phenotype: dies out at 25C, grows at 20C, but best kept at 18-20C. Not known whether it is the mut-7 allele that is ts or something else.

The mdt-15(et14) gain-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. The C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Svensk E, et al. PLoS Genetics 9:e1003801. PMID: 24068966

The fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65°C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgtag; et46_mut:atcccccaaaaaacccaatttttttgtaa; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349