More Fields
Strain Species Genotype
ALF63 C. elegans unc-119(ed3) III; bafIs63. Show Description
bafIs63 [lin-42p(mut)::GFP + unc-119(+)]. lin-42p(mut)::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+); all potential DAF-12 binding sites have been mutated. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
CB1396 C. elegans mut-1(e1396). Show Description
Mutator.
CH118 C. elegans nid-1(cg118) V. Show Description
Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer.
CH119 C. elegans nid-1(cg119) V. Show Description
Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. Molecular null, deletion removes promoter region. Homozygous viable and fertile, fecundity reduced by approximately 30%. nid-1=F54F3.1.
CX3019 C. elegans mut-2(r459) I; dpy-19(n1347) glr-1(ky176) III. Show Description
Nose touch defective (recessive). Mechanosensory defective (semi-dominant). Mildly Dpy (ts).
DM4415 C. elegans unc-52(st196ra515) II. Show Description
WT phenotype. May still carry mut-4(st700).
DM4417 C. elegans mut-4(st700) I; unc-52(st196ra517) II. Show Description
WT movement and body wall muscle.
DR7 C. elegans unc-33(m7) IV; mut-1(e1396). Show Description
Unc.
DR842 C. elegans mut-4(st700) I; mut-5(st701) II; unc-22(st136m498) IV. Show Description
Non-Twitchers. Still contains Tc1. Temperature sensitive. Sterile at 25C, grows ok at 20C. Dauer larvae are SDS resistant.
GR1747 C. elegans mut-15(tm1358) V. Show Description
Him. Mutator. RNAi-defective. Temperature-sensitive sterile at 25C. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.
GR1748 C. elegans unc-119(ed3) III; mgSi2 IV. Show Description
mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.
GR1823 C. elegans mut-16(mg461) I. Show Description
RNAi-deficient in soma. Reference: Zhang C, et al. Proc Natl Acad Sci U S A. 2011 Jan 25;108(4):1201-8.
JK3826 C. elegans mut-16(mg461) I; larp-1(q783) III. Show Description
Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK4545 C. elegans larp-1(q783) III. Show Description
Derived by outcrossing JK3826 to remove mut-16 deletion. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK4842 C. elegans qSi29 II; unc-119(ed3) III. Show Description
qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK5072 C. elegans qSi29 II; unc-119(ed3) III; teIs1 IV. Show Description
qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. teIs1 [oma-1::GFP + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
MT3126 C. elegans mut-2(r459) I; dpy-19(n1347) III. Show Description
Very mildly Dpy Tc1-induced dpy-19 allele. Generates severe Dpys when Tc1 hops out of dpy-19 (doesn't excise cleanly). See also WBPaper00001672. [Some concern whether the Mut phenotype in this strain is actually mut-2 because it showed no transposition of Tc3 or other Tc's besides Tc1. 1/95.]
NL1100 C. elegans mut-2(r459) I; prk-1(pk86::Tc1) III. Show Description
Insertion in CCTTCAGAAG TA TGTCATTTGG.
NL1136 C. elegans mut-2(r459) I; gpa-5(pk375) X. Show Description
NL1800 C. elegans mut-16(pk700) I. Show Description
NL1810 C. elegans mut-16(pk710) I. Show Description
NL1820 C. elegans mut-7(pk720) III. Show Description
Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator.
NL1834 C. elegans mut-9(pk734) Show Description
Mutator.
NL1838 C. elegans mut-14(pk738) Show Description
Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA.
NL2010 C. elegans mut-6(st702) IV; rsd-3(pk2010) X. Show Description
Mut. RNAiR.
NL242 C. elegans mut-2(r459) I; flp-1(pk41::Tc1) IV. Show Description
TTTAAAACG TA CTTACCTTT
NL243 C. elegans mut-2(r459) I; ZK637.13(pk42) III. Show Description
insertion: TTCTGTGAAC TA TGTCAAAAT
NL244 C. elegans nhr-2(pk43::Tc1) mut-2(r459) I. Show Description
Dpyish.
NL245 C. elegans mut-2(r459) I; elt-2(pk46::Tc1) X. Show Description
Insertion in GGTCAAACG TA AGTTAAAGT.
NL3531 C. elegans rde-2(pk1657) I. Show Description
Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat. AKA mut-8.Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat.Mutator.
NL665 C. elegans mut-6(st702) IV. Show Description
NL705 C. elegans glc-2(pk55); mut-2(r459) I. Show Description
glc-2(pk55) previously called avm-2(pk55).
NL706 C. elegans mut-2(r459) cap-1(pk56::Tc1) I. Show Description
NL708 C. elegans mut-2(r459) I; cct-1(pk58::Tc1) II. Show Description
TTCTCACA TA ATTCCGATCT. Somewhat Dpyish.
NL711 C. elegans mut-2(r459) I; feb-1(pk61). Show Description
NL712 C. elegans mut-2(r459) I; sem-2(pk64). Show Description
NL713 C. elegans mut-2(r459) I; sox-2(pk65). Show Description
K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.
NL714 C. elegans mut-2(r459) I; sox-3(pk66). Show Description
F40E10.2. Location of the insertion: ATTAATAATA TA ACTATTGAAA.
NL716 C. elegans mut-2(r459) I; sod-4(pk68) III. Show Description
F55H2.
NL723 C. elegans mpk-1(pk79) mut-2(r459) I. Show Description
NL726 C. elegans mut-2(r459) I; kin-18(pk71) III. Show Description
T17E9.1
NL737 C. elegans mut-2(r459) I; mek-1(pk97) X. Show Description
K08A8.1 Previously called kin-17(pk97).
NL742 C. elegans rskn-1(pk209::Tc1) mut-2(r459) I. Show Description
Dpyish. Primers used to isolate pk209 are: cgatcctcgacagtttgaactgc & cgagattcagggcatgtctatgc.
NL917 C. elegans mut-7(pk204) III. Show Description
Mutator strain. Throws males. See WBG 14(2): 24. Strain has a ts phenotype: dies out at 25C, grows at 20C, but best kept at 18-20C. Not known whether it is the mut-7 allele that is ts or something else.
PS1678 C. elegans mut-2(?) goa-1(pk62) I. Show Description
QC152 C. elegans mdt-15(et14) III. Show Description
The mdt-15(et14) gain-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. The C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Svensk E, et al. PLoS Genetics 9:e1003801. PMID: 24068966
QC153 C. elegans fld-1(et46) I. Show Description
The fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65°C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgcag; et46_mut:atcccccaaaaaacccaatttttttgtag; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349
QC155 C. elegans nhr-49(et8) I; mdt-15(et14) III. Show Description
This double mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
QC156 C. elegans acs-13(et54) nhr-49(et8) I; mdt-15(et14) III. Show Description
This triple mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The acs-13(et54) mutation (G125R) can be detected using PCR with the following primers: WT FWD: 5´CTA CCA GGG TGT TCG CCA TG 3; acs-13 mutant FWD: 5´CTA CCA GGG TGT TCG CCA TA 3; acs-13 REV: 5´TCA AAC TTG GGC ATT GCT CC 3´. Annealing 65°C, expected product 395 bp. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
RW7080 C. elegans mut-4(st700) I; mut-5(st701) II; unc-22(st136) IV. Show Description
Uncoordinated Twitchers, moves slowly with constant twitching. Thin. Egl. Mutators give spontaneous reversion of unc-22.