| RG3355 |
C. elegans |
rpl-38(ve855[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous sterile. Deletion of 5417 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ sterile (ve855 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type dim GFP+. May grow better at 15C. Left flanking Sequence: GGCTTCAACTATATTTTAATTTTTCAGGTA; Right flanking sequence: GCTCAAGTAGATCAAATCTCTTCTCTGCTC. rpl-38 sgRNA #1: ATCCACCATTGCGATGCCAA; rpl-38 sgRNA #2: TCCTTGACTTGGATGCCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
