Strain Information
Name | RG3239 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | ZK858.7(ve739[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. |
Description | umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous lethal. Deletion of 2453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 lethals(lethal mid-larval to adult) (ve739 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation in hT2 is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: catattattaaattttaagtgtaaaagatt ; Right flanking sequence: aggcaacagagaacgaacgataaagtagtc. sgRNA #1: gaggaaatatgcaatttact; sgRNA #2: atcgacgagacggctacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | RG KO Group |
Laboratory | RG |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.