More Fields
Strain Species Genotype
QC146 C. elegans fld-1(et49) I; iglr-2(et34) III. Show Description
The fld-1 mutation acts as a suppressor of iglr-2 but the strain still displays weak version of the iglr-2 phenotypes including reduced growth in the presence of glucose or at 15°C, and occasionally produces a tail tip defect.
QC142 C. elegans fld-1(et45) I; paqr-2(tm3410) mdt-15(et14) III. Show Description
No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2.
QC145 C. elegans fld-1(et48) I; paqr-2(tm3410) mdt-15(et14) III. Show Description
No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2.
QC153 C. elegans fld-1(et46) I. Show Description
The fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65°C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgcag; et46_mut:atcccccaaaaaacccaatttttttgtag; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349