Strain Information

Name QC153   View On Wormbase
Species C. elegans
Genotypefld-1(et46) I.
DescriptionThe fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65°C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgcag; et46_mut:atcccccaaaaaacccaatttttttgtag; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349
MutagenEMS
Outcrossedx10
Made byRakesh Bodhicharla
Laboratory QC
Reference Ruiz, M., Bodhicharla, R., Svensk, E., Devkota, R., Busayavalasa, K., Palmgren, H., Ståhlman, M., Boren, J. and Pilon, M. (2018). Membrane fluidity is regulated by the C. elegans transmembrane protein FLD-1 and its human homologs TLCD1/2. eLife 7:e40686.
Sign in or register an account if you want to order this strain.