Strain Information
| Name | QC153 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | fld-1(et46) I. |
| Description | The fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65°C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgtag; et46_mut:atcccccaaaaaacccaatttttttgtaa; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349 |
| Mutagen | EMS |
| Outcrossed | x10 |
| Made by | Rakesh Bodhicharla |
| Laboratory | QC |
| Reference | Ruiz, M., Bodhicharla, R., Svensk, E., Devkota, R., Busayavalasa, K., Palmgren, H., Ståhlman, M., Boren, J. and Pilon, M. (2018). Membrane fluidity is regulated by the C. elegans transmembrane protein FLD-1 and its human homologs TLCD1/2. eLife 7:e40686. |
Sign in
or
register an account if you want to order this strain.