More Fields
Strain Species Genotype
SX157 C. elegans prg-1(n4357) I; unc-22(st136) IV. Show Description
Transposon silencing normal.
SX158 C. elegans prg-1(n4357) I; unc-22(r750) IV. Show Description
Twitching due to transposon insertion in unc-22. [(07/16/2018) NOTE: A user has reported their PCR and sequence analysis suggest this strain contains does not still contain Tc3, but retains loss unc-22 function, apparently due to imprecise excision.]
SX166 C. elegans prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV. Show Description
Transposon silencing normal.
SX178 C. elegans prg-1(n4357) I; unc-22(r765) IV. Show Description
Twitching due to transposon insertion in unc-22.
SX278 C. elegans prg-1(n4357) I; prg-2(n4358) unc-22(r765) IV. Show Description
Transposon silencing normal.
SX523 C. elegans prg-1(n4357) I; prg-2(n4358) IV. Show Description
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Sterile at 25.5C; maintain at 20C or below.
SX922 C. elegans prg-1(n4357) I. Show Description
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT//GATGCTCATATTGTAATCT.