Search Strains

No phenotype. Contains a 2063 bp deletion in the smf-1 locus (K11G12.4) from position 17016 to position 19079 on the K11G12 cosmid. eh5 was obtained from the Sanger Centre Knockout Service in strain HX104. Reference: Au C, et al. PLoS One. 2009 Nov 18;4(11):e7792.

kyIs140 [str-2::GFP + lin-15(+)] I. vyEx1462 (die-1(fosmid)::Venus + odr-1::DsRed + ofm-1::DsRed). Pick animals with DsRed+ coelomocytes to maintain. Animals with vyEx1462 show 2AWC(OFF) phenotype. Extrachromosomal array rescues die-1(w34).

kyIs140 [str-2::GFP + lin-15(+)] I. vyEx1510 (ceh-36p::die-1(cDNA) + odr-1::DsRed + ofm-1::DsRed). Pick animals with DsRed+ coelomocytes to maintain. Animals with vyEx1510 show 2AWC(OFF) phenotype.

axEx1125 [pie-1p::mex-5::GFP::pie-1 3’UTR + rol-6(su1006) + N2 genomic DNA]. Maintain at 25C. Pick Rollers to maintain. axEx1125 contains pKR2.04, a construct carrying MEX-5::GFP in vector pKR1.42; pKR1.42 uses the pie-1 promoter, enhancer, and 3? UTR to drive maternal expression of GFP in embryos. Animals with the array are Rollers. Animals which have lost the array are WT.

itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C. Constructed by crossing heterozygous ojIs1 males into KK866 (itIs153) hermaphrodites and selecting for double homozygosity of the arrays. itIs153 is an integrated derivitive of axEx1094.

ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.

ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.

jinEx10 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Pick Rollers to maintain. hlh-30::GFP expression should be visible at relatively low magnification. Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.

zuEx181[his-72(1kb 5' UTR)::YFP::GSRPVAT::HIS-72::HIS-72 (1KB 3'UTR) + 5.7 kb XbaI - HindIII UNC-119(+)]. HIS-72::YFP signal can be detected in the germline and most somatic nuclei, but not in intestinal nuclei.

zuEx182[his-71(1kb 5' UTR):: HIS-71::GSRPVAT::GFP::::HIS-71 (1KB 3'UTR) + 5.7 kb XbaI - HindIII UNC-119(+)]. HIS-71::YFP signal can be detected in most somatic nuclei, including the intestinal nuclei, but is not detected in the germline.

qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi424 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter and GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

vxEx105 [dat-1p::ChR2::mCherry + myo-2p::mCherry]. Raise on retinal for optogenetic manipulations (per Vidal-Gadea, 2011). Not necessary for survival. Reference: Vidal-Gadea A, et al. Proc Natl Acad Sci U S A. 2011 Oct 18;108(42):17504-9.

seaEx13 [fmo-2p::GFP + unc-119(+)]. Pick non-Unc to maintain. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.

itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. Maintain at 25C. itIs153 is an integrated derivitive of axEx1094.

WT. Segregates WT and DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

WT strain which segregates DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Unc. Segregates DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

hEx10 [C12H4 + M01A12 + C07F10 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 57% Unc Rollers. Maintain by picking Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

hEx15 [C07F10 + C04F1 + C53A11 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 39% Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

hEx16 [C32E7 + rol-6(su1006)]. Segregates 65% Unc Rollers. Semi-sterile: high sterility rate and low brood size. Maintain by picking Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

kasEx147 [oig-1p(1.6kb)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 1.6kb cis-regulatory region (-2.6-1.0kb) upstream of oig-1 was fused to GFP with the unc-54 3'UTR. oig-1 uses mulitple cis-regulatory regions to achieve different expression patterns in motor neurons; this construct drives expression specifically in cholinergic motor neurons. Construct was injected into N2 worms. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx149 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 200bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is been abolished; expression was observed specifically in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx151 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 300bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is retained, but eliminates ectopic expression in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx157 [unc-11p::C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821

kasEx159 [unc-11p::(delta)C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene has the unc-11 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821

kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821

rnyEx109 [nhx-2p::D3cpv + pha-1(+)]. Maintain at 20-25C to select for array. KWN190 strain expresses the FRET-based calcium indicator protein D3cpv throughout the cytoplasm of intestinal cells. Dual emission ratio imaging (ex. 435, em. 480/535-nm) can be used to measure intestinal calcium and, although the FRET pair is CFP/YFP, intestinal D3cpv fluorescence is observable under standard GFP filter sets. The D3cpv biosensor has the advantages of being relatively pH-insensitive and not interfering with endogenous calmodulin signaling. References: Am J Physiol Cell Physiol. 301:C1389-1403. Am J Physiol Cell Physiol. 297:C1071-81. FASEB J. 27:760-768. PLoS Biol. 11: e1001613.

rnyEx133 [opt-2p:::opt-2(aa1-412)::GFP) + pha-1(+)]. Maintain at 25C to select for animal carrying the array. Labels apical intestinal membrane. Reference: Nehrke (2003) 278(45):44657-66.

At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.

bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Temperature sensitive induction of germ cell apoptosis at 25 C. Large number of germ cells are decorated by CED-1::GFP within 48 h. Activates CED-3-mediated cleavage of IFG-1, visualized by western blot (Contreras, V., et al, 2011).

No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).

In-frame CRISPR/Cas9 fusions into the genes encoding the eIF4E paralogs IFE-1 and IFE-3. Red and Green fluorescence, respectively. Strong fluorescence for both in the hermaphrodite and male gonads, but with distinct expression character and germ granule association. Germ cell cytoplasmic expression and lesser somatic expression are also observed. Both insertions are homozygous by PCR confirmation.

C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).

Serotonin- and dopamine-deficient, tetrahydrobiopterin-deficient, general chemical hypersensitivity, cuticle fragility (rapid disintegration in alkaline bleach), male turning defective (phenotypes appear identical to cat-4 null mutants). Derived by outcrossing FX1984 five times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.

ldEx1050 [pcst-1p::pcst-1::GFP +rol-6(su1006)]. Maintain by picking Rollers. Reference: Lehtinen MK, et al. Cell. 2006 Jun 2;125(5):987-1001.

Hyperactive.

cc561 is temperature sensitive. Grow at 15C.

lstEx112 [unc-119p::pdfr-1a::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. Neuron-specific expression of pdfr-1a isoform rescues pdfr-1 locomotion defects; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

lstEx117 [unc-119p::pdfr-1b::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. Neuron-specific expression of pdfr-1b isoform rescues pdfr-1 locomotion defects; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

lstEx122 [unc-119p::pdfr-1c::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. Neuron-specific expression of pdfr-1c isoform rescues pdfr-1 locomotion defects; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

vs163 is a 169 bp deletion removing exon 2 and causing frameshift.

Egl. Aldicarb-resistant.

Very weak Egl. rgs-1=C05B7.7, a C. elegans RGS (Regulator of G protein Signaling) gene. nr2017 is a presumptive null allele. nr2017 is a 638 bp deletion of sequences whose limits are CGAGAAATTGTCAACACTAAC...GTTTGGAATGGTTTATCAGTT. The deleted material is replaced by the following 35 bp insertion: TATGTTTAAGTTAAGTTTATAGTTTAAGTTTAAAG.

rgs-2=F16H9.1, a C. elegans RGS (Regulator of G protein Signaling) gene. vs17 is a presumptive null allele. vs17 is a 1136 bp deletion of sequences with limits: ATATATATATCTCATTACTGG...AATCAAGTGTAACACTAATAT. rgs-1;rgs-2 double mutants fail to rapidly turn on egg-laying behavior when fed after starvation.