| FG928 |
C.elegans |
inx-1(tm3524) X. Show Description
Derived by out-crossing parental strain FX18538 five times.
|
|
| FX1053 |
C. elegans |
ins-11(tm1053) II. Show Description
Superficially wild type. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| FX11364 |
C. elegans |
pps-1(tm1109)/mec-3(u297) IV. Show Description
Heterozygotes are WT and segregate WT, Mec and larval lethals. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| FX1146 |
C. elegans |
sod-5(tm1146) II. Show Description
Homozygous viable. 775 bp deletion. 24926/24927 - 25701/25702. Primer 1: att gcc aat gcc gtt ctt cc (forward primer to the left of deletion). Primer 2: tat tat ttc gcg tcg gag cg (forward primer lies in the deletion). Primer 3: att tat gca gga gcg gca ag (reverse primer to the right of deletion). In sod-5(+) you see 720 bp product with primer 2 and 3. reliable PCR. in sod-5(+) expected product size is 1315 bp with primer 1 and 3. not always reliable. In sod-5 (tm1146) you see 540 bp product with primer 1 and 3. reliable PCR. In sod-5(tm1146), you see no product with primer 2 and 3. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| FX11501 |
C. elegans |
dpy-5(e61) uri-1(tm939)/dpy-5(e61) unc-14(e57) I. Show Description
Heterozygotes are Dpy. Segregate Dpy Unc. tm939 homozygotes are emb, leth, pvl, rup, larval arrested or sterile. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| FX11507 |
C. elegans |
rabs-5(tm2036) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested nT1 aneuploids, and non-GFP tm2036 homozygotes. tm2036 homozygotes are temperature sensitive lethal, and can be maintained as homozygotes at 15C. tm2036 homozygotes have endocytosis defects in oocytes and coelomocytes at 25C. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| FX11552 |
C. elegans |
vps-45(tm246)/egl-17(e1313) lon-2(e678) X. Show Description
Heterozygotes are WT and segregate WT, Egl Lon, and tm246 homozygotes (temperature sensitive lethal which can be maintained as homozygotes at 15C). tm246 homozygotes have endocytosis defects in oocytes and coelomocytes at 25C. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| FX1524 |
C. elegans |
cku-70(tm1524) III. Show Description
Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| FX17650 |
C. elegans |
lin-1(tm5929)/tmIn1 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(egl-4 unc-17) IV. Covered region (Mb) 1.8 (1.8..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
| FX17788 |
C. elegans |
mlt-7(tm1794)/tmIn4 II. Show Description
Heterozygotes are slightly Dpy, and segregate slightly Dpy mlt-7/tmIn4 heterozygotes, Dpy tmIn4 homozygotes, and mlt-7(tm1794) homozygotes (Let). Break points: In(lin-8 dpy-2) II. Covered region (Mb) 3.7 (3.1..6.7) Dpy. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
| FX19059 |
C. elegans |
Y38F2AR.9(tm1986)/tmIn3 IV. Show Description
Homozygous lethal deletion allele balanced by Unc-marked translocation. Pick wild-type to maintain. Heterozygotes are wild-type and segregate wild-type (heterozygotes), Let (tm1986 homozygotes), and larval arrest (tmIn3 homozygotes). Break points: In(jtr-1 unc-17) IV. Covered region (Mb) 2.2 (1.4..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
| FX19119 |
C. elegans |
atm-1(tm5027) C46H11.6(tm7811) I; tmIn20 II; xpc-1(tm3886) F01D4.9(tm7812) IV; aqp-4(tm7813) V. Show Description
tmIn20 is an inversion between F46C5.9 and C08H9.13 in LG II. Inversion strain obtained by Next-generation sequencing.
|
|
| FX19120 |
C. elegans |
atm-1(tm5027) Y47G6A.28(tm7889) nepr-1(tm7890) I; C18H9.6(tm7891) II; xpc-1(tm3886) tmIn21 IV; srh-54(tm7892) V. Show Description
tmIn21 is an inversion between pck-3 and R09H10.5 in LG IV. Inversion strain obtained by Next-generation sequencing.
|
|
| FX19134 |
C. elegans |
tmIn8 II. Show Description
Break points: In(F13D12.6 Y51H1A.2) II. Covered region (Mb) 2.1 (11.7..13.9) Obtained by TMP/UV. (Note: Y51H1A.2 has been renamed cup-14.) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19141 |
C. elegans |
atm-1(tm5027) C37A2.6(tm8115) I; Y48A6B.8(tm8116) III; xpc-1(tm3886) IV; tmIn22 V. Show Description
tmIn22 is an inversion between W02G9.9 and 21ur-15544 in LG V. Inversion strain obtained by Next-generation sequencing.
|
|
| FX19161 |
C. elegans |
dpy-20(tm5940)/tmIn5 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(mec-3 unc-31) IV. Covered region (Mb) 2.3 (10.5..12.8) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19163 |
C. elegans |
mca-3(tm6395)/tmIn11 IV. Show Description
Homozygous lethal deletion allele balanced by Unc-marked translocation. Heterozygotes are wild-type and segregate wild-type heterozygotes, lethal tm6395 homozygotes, and Unc tmIn11 homozygotes. Break points: In(kvs-5 unc-17) IV. Covered region (Mb) 2.9 (0.7..3.6) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19170 |
C. elegans |
lin-1(tm5929)/tmIn2 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(ced-2 unc-17) IV. Covered region (Mb) 2 (1.6..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
| FX19171 |
C. elegans |
lig-4(tm750) III; tmIn26 X. Show Description
tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
| FX19173 |
C. elegans |
lig-4(tm750) III; tmIn19 V. Show Description
Break points: In(unc-23 lon-3) V. Covered region (Mb) 3.3 (8.9..12.2) Lon Unc. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19181 |
C. elegans |
unc-15(tm6329)/tmIn14 I. Show Description
Homozygous lethal deletion allele balanced by Dpy-marked translocation. Break points: In(dpy-5 lin-10) I. Covered region (Mb) 2.7 (5.4..8.1). Pick wild-type to maintain. Heterozygotes are wild-type and segregate wild-type heterozygotes, Dpy (tmIn14 homozygotes), and unc-15 homozygotes. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19397 |
C. elegans |
tmC1 X; tmEx4487. Show Description
tmEx4487 [unc-18(+) + myo-2p::Venus]. Break points: In(F53B1.2 unc-18 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2.1..8.5) Lon Mec (Unc). Pick fluorescent non-Unc to maintain array. Males carrying the array (Venus in pharynx) can mate. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
| FX19472 |
C. elegans |
tmIn10 II. Show Description
Break points: In(ZK1240.1 F29A7.8) II. Covered region (Mb) 0.4 (2.3..2.8) Obtained by TMP/UV. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19584 |
C. elegans |
lig-4(tm750) III; tmIn51 IV. Show Description
tmIn51 is a CRISPR/Cas9-induced inversion between C09G12.5 and C01B10.3 in LG IV.
|
|
| FX19585 |
C. elegans |
lig-4(tm750) tmIn52 III. Show Description
Break points: In(hpr-9 ttr-52) III. Covered region (Mb) 2.8 (10.6..13.4) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19666 |
C. elegans |
tmC5 IV. Show Description
Break points: In(C01B10.3 eak-7 In(mec-3 unc-31)) IV. Covered region (Mb) 6.2 (6.6..12.8) Mec Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19668 |
C. elegans |
tmC6 [dpy-2(tmIs1189)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19702 |
C. elegans |
lig-4(tm750) III; tmIn54 V. Show Description
Break points: In(srbc-66 T10H9.8) V. Covered region (Mb) 3.1 (3.5..6.7) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19704 |
C. elegans |
tmIn58 I; lig-4(tm750) III. Show Description
Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19706 |
C. elegans |
lig-4(tm750) III; tmIn60 X. Show Description
Break points: In(odr-7 F59F4.2) X. Covered region (Mb) 3.4 (12.5..15.8) Unknown if tmIn60 homozygotes are Odr. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX19992 |
C. elegans |
lig-4(tm750) III; tmIn62 IV. Show Description
Break points: In(kvs-5 dmd-9) IV. Covered region (Mb) 2.5 (0.7..3.3) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| GLW16 |
C. elegans |
rab-7(utx12[mNG::rab-7]) II. Show Description
Superficially wild-type. N-terminal tag of RAB-7 via CRISPR/Cas9 knock-in of mNeonGreen at rab-7 locus. Insertion verified by PCR. Left flank: 5' gcacaacaaaaaggcttccagtgaacaaaa 3'; Right flank: 5' ATGTCGGGAACCAGAAAGAAGGCGCTGCTC 3'. sgRNA: 5' cttccagtgaacaaaaATGT 3'
|
|
| GLW19 |
C. elegans |
mpk-1(utx14[mNG::mpk-1]) III. Show Description
Superficially wild-type. N-terminal tag of MPK-1 via CRISPR/Cas9 knock-in of mNeonGreen at mpk-1 locus. Insertion verified by PCR. Left flank: 5' tagaaatttaaaattcatttcttcttgcag 3'; Right flank: 5' ATGGCCGACGGAGAAGCGGTTATCTCGACG 3'. sgRNA: 5' ttcttcttgcagATGGCCGA 3'
|
|
| GLW25 |
C. elegans |
daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
|
|
| GN517 |
C. elegans |
pgEx116. Show Description
pgEx116 [unc-70::TSmod + myo3p::mCherry]. Pick animals with red fluorescence in body wall muscle to maintain array. The tension sensor module (TSMod) was inserted into the coding sequence of unc-70. TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, which acts as an entropic nanospring suitable for estimating biologically relevant forces. Reference: Krieg M, et al. Nat Cell Biol. 2014 Mar;16(3):224-33.
|
|
| GN600 |
C. elegans |
pgIs22 IV; oxIs95. Show Description
pgIs22 [unc-70::N-TSmod]. oxIs95 [pdi-2p::unc-70 + myo-2p::GFP]. The tension sensor module control (N-TSMod) was inserted at the N-terminus of unc-70. N-TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, but is placed at the N-terminus of UNC-70 where it is not sensitive to force. pgIs22 was a spontaneous insertion of pgEx157. Reference: Kelley M, et al. Elife. 2015 Mar 23;4.
|
|
| GR2183 |
C. elegans |
mgIs72 II. Show Description
mgIs72 [rpt-3p::GFP + dpy-5(+)] II. Reporter of proteasome subunit expression can be used to assay skn-1a-dependent regulation of proteasome subunit genes. mgIs72 [rpt-3::gfp] integrated transgene was generated from sEx15003.
|
|
| HR596 |
C. elegans |
sbEx133. Show Description
sbEx133 [mel-11::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| HR606 |
C. elegans |
sbEx136. Show Description
sbEx136 [(pAW33.1) let-502p::GFP + rol-6(su1006)]. pAW33.1 is about 6.6 kb BamH1 fragment from K06G1 and includes the first 12 amino acids of LET-502 clones into pPD95.67/BamH1. Should be nuclear localized, but is not nuclear localized. Maintain by picking Rollers.
|
|
| HS616 |
C. elegans |
osEx108. Show Description
osEx108 [(pAY105) let-19::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Reference: Yoda et al. Development (2005) vol. 132 (8) pp. 1885-93.
|
|
| HS845 |
C. elegans |
osEx138. Show Description
osEx138 [let-526::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. GFP expression in most somatic nuclei. Reference: Shibata Y, et al. Dev Biol. 2012 Jan 15;361(2):349-57.
|
|
| HS942 |
C. elegans |
unc-76(e911) V; osEx158. Show Description
osEx158 [wrm-1::GFP + unc-76(+)]. Animals with the array are WT and GFP+. Animals which have lost the array are Unc and GFP-.
|
|
| HX103 |
C. elegans |
chd-3(eh4) X. Show Description
T14G8.1 Deletion of 2018 bp of T14G8.1 [nucleotide 3699 (in exon 4) joined to 1682 (in exon 6)]. No phenotype observed.
|
|
| IC459 |
C. elegans |
sax-3(ky123) X; quEx102. Show Description
quEx102[F25B3.3::SAX-3 + odr-1::RFP]. F25B3.3::SAX-3 partially rescues the lethality and notch phenotype of sax-3(ky123). Maintain by picking RFP+.
|
|
| IC464 |
C. elegans |
sax-3(ky123) X; quEx100. Show Description
quEx100 [ajm-1::sax-3 + odr-1::RFP]. ajm-1::sax-3 partially rescues the lethality of sax-3(ky123). Maintain by picking RFP+.
|
|
| IC611 |
C. elegans |
quEx128. Show Description
quEx128 [npr-9::GFP + rol-6(su1006)]. Maintain by picking Rollers. ZK455.3 is npr-9 and is expressed in AIB neuron.
|
|
| IC692 |
C. elegans |
quEx162. Show Description
quEx162 [sax-3p::GFP + rol-6(su1006)]. Pick GFP to maintain. Very bright GFP in early embryos (after 24 cell stage). Not all GFP+ worms are rolling.
|
|
| IC699 |
C. elegans |
sax-3(ky123) ; quEx168. Show Description
quEx168 [sax-3::GFP + odr-1::RFP]. Pick RFP+ to maintain. GFP is visible at higher magnification but fades quickly. Strongest GFP is in the head region. The Chin-Sang Lab recommends researchers use this strain instead of IC450, as sax-3::GFP expression in IC699 is more consistent than in the comparable strain IC450.
|
|
| IC765 |
C. elegans |
npr-9(tm1652) X; quEx182. Show Description
quEx182 [npr-9(+) + sur-5::GFP + odr-1::RFP]. Maintain by picking GFP+. Rescuing npr genomic fragment co-injected with sur-5::GFP and odr-1::RFP]. transgenic (GFP+) animals tend to wander off the food.
|
|
| IG444 |
C. elegans |
frEx113. Show Description
frEx113 [(pJL44) transposase + col-12p::DsRed]. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.
|
|