Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
ABR291 C. elegans pha-1(cc1299) III; staEx19. Show Description
staEx19 [ges-1p::F53B6.4::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. F53B6.4 tagged with WormScarlet to visualize secretion of the protein.
BB93 C. elegans dcr-1(ok247) III; uuEx19. Show Description
uuEx19 [dcr-1(K39A) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.
CE1190 C. elegans unc-74(x19) gla-3(ep312) I. Show Description
Gla. May contain dam-1(op241) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CT18 C. elegans zaEx19. Show Description
zaEx19 [mir-48::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.
EJ521 C. elegans lin-45(dx19) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, non-Unc Steriles, larval lethals and dead eggs. dx19 is a strong lin-45 raf allele: dx19 homozygotes from dx19/+ heterozygous parents are 13% larval lethal and among the adults, 100% are Sterile and Vul.
GLW25 C. elegans daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
KR1236 C. elegans unc-74(x19) dpy-5(e61) I; hDp2 (I;f). Show Description
WT. Segregates WT and DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1626 C. elegans unc-74(x19) dpy-5(e61) I; hDp77 (I;f). Show Description
WT strain which segregates DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1754 C. elegans unc-74(x19) dpy-5(e61) I; hDp29 (I;f). Show Description
Unc. Segregates DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
VL347 C. elegans unc-119(ed3) III; wwEx19. Show Description
wwEx19 [mir-230p::GFP + unc-119(+)]. Maintain by picking non-Unc.
ZZ1012 C. elegans unc-74(x19) dpy-5(e61) I. Show Description
AGK532 C. elegans unc-119(ed3) III; niDf199 IV; armEx196. Show Description
armEx196 [mex-5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to deletion of the niDF199 locus. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
AGK537 C. elegans unc-119(ed3) III; armEx199. Show Description
armEx199 [cdl-1p::cdl-1::GFP + unc-119(+)]. Pick non-Unc to maintain. Nuclear localization of CDL-1::GFP in the germline and early embryos; strong enrichement of CDL-1::GFP in the nuclei of developing oocytes. Reference: Avgousti DC, et al. EMBO J. 2012 Oct 3;31(19):3821-32.
AY190 C. elegans acEx190. Show Description
acEx190 [tax-2p::CZ::ced-3(p17)::unc-54 3’UTR + lim-6p::ced-3(p15)::NZ::unc-54 3’UTR + myo-3p::mCherry]. Pick mCherry+ to maintain.  ASG is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the tax-2 and lim-6 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721.
AY191 C elegans acEx191. Show Description
acEx191 [odr-2p::CZ::ced-3(p17)::unc-54 3’UTR+ unc-53p::ced-3(p15)::NZ::unc-54 3’UTR + rol-6(su1006)]. Pick Rollers to maintain.  PVP is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the odr-2 and unc-53 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721.
BC5022 C. elegans sEx190. Show Description
sEx190 [F58A4 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul F54A8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5025 C. elegans sEx193. Show Description
sEx193 [R05D3 (III) + pCes1943[rol-6(su1006)]]. 4 ng/ul mini-prepped cosmid R05D3 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5026 C. elegans sEx194. Show Description
sEx194 [R10E11 + pCes1943[rol-6(su1006)]]. 20 ng/ul R10E11 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
CGC83 C. elegans tmIn8 [umnIs64] II. Show Description
umnIs64 [myo-2p::GFP + NeoR, II:12833878 (intergenic)] II. tmIn8 is a CRISPR/Cas9-induced inversion between F13D12.6 and cup-14 in LG II covering region (Mb) 2.1 (11.7..13.9). Derived by insertion of myo-2p::GFP transgene into parental strain FX19134 using CRISPR/Cas9.
CGC87 C. elegans tmIn54 [umnIs69] V. Show Description
umnIs69 [myo-2p::GFP + NeoR, V:4308261(intergenic)] V. Break points: In(srbc-66 T10H9.8) V. Covered region (Mb) 3.1 (3.5..6.7). Derived by insertion of myo-2p::GFP transgene into parental strain FX19702 using CRISPR/Cas9.
CGC88 C. elegans tmIn26 [umnIs70] X. Show Description
umnIs70 [myo-2p::GFP + NeoR, X:6745526(intergenic)] X. tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. Derived by insertion of myo-2p::GFP transgene into parental strain FX19171 using CRISPR/Cas9.
CGC89 C. elegans tmIn58 [umnIs68] I; lig-4(tm750) III. Show Description
umnIs68 [myo-2p::GFP + NeoR, I:6284001(intergenic)] I. Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3). Derived by insertion of myo-2p::GFP transgene into parental strain FX19704 using CRISPR/Cas9.
CH1445 C. elegans unc-119(ed3) III; cgEx198. Show Description
cgEx198 [(pJC14) bli-1::GFP + unc-119(+)]. Pick non-Unc to maintain. Transgene rescues bli-1 phenoptype. GFP expression is detectable in late L4-adult.
DG3614 C. elegans inx-8(tn1474) inx-9(ok1502) IV; tnEx195. Show Description
tnEx195 [inx-8(+) + inx-9(+) + sur-5::GFP]. Pick GFP+ animals to maintain. Animals carrying tnEx195 are wild-type; animals that have lost the array are sterile and produce few germ cells. Reference: Starich TA, Hall DH, Greenstein D. Genetics. 2014 Nov;198(3):1127-53.
DM7190 C. elegans pha-1(e2123) III; raEx190. Show Description
raEx190 [T05G5.1p::M05D6.5(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7191 C. elegans pha-1(e2123) III; raEx191. Show Description
raEx191 [T05G5.1p::F02E9.1(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7192 C. elegans pha-1(e2123) III; raEx192. Show Description
raEx192 [T05G5.1p::Y54G11A.11(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7194 C. elegans pha-1(e2123) III; raEx194. Show Description
raEx194 [T05G5.1p::Y37D8A.10(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7198 C. elegans pha-1(e2123) III; raEx198. Show Description
raEx198 [T05G5.1p::F25H2.12(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7199 C. elegans pha-1(e2123) III; raEx199. Show Description
raEx199 [T05G5.1p::T20D3.6(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
EG199 C. elegans nas-37(ox199) X. Show Description
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.
FX19059 C. elegans Y38F2AR.9(tm1986)/tmIn3 IV. Show Description
Homozygous lethal deletion allele balanced by Unc-marked translocation. Pick wild-type to maintain. Heterozygotes are wild-type and segregate wild-type (heterozygotes), Let (tm1986 homozygotes), and larval arrest (tmIn3 homozygotes). Break points: In(jtr-1 unc-17) IV. Covered region (Mb) 2.2 (1.4..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
FX19119 C. elegans atm-1(tm5027) C46H11.6(tm7811) I; tmIn20 II; xpc-1(tm3886) F01D4.9(tm7812) IV; aqp-4(tm7813) V. Show Description
tmIn20 is an inversion between F46C5.9 and C08H9.13 in LG II.  Inversion strain obtained by Next-generation sequencing.
FX19120 C. elegans atm-1(tm5027) Y47G6A.28(tm7889) nepr-1(tm7890) I; C18H9.6(tm7891) II; xpc-1(tm3886) tmIn21 IV; srh-54(tm7892) V. Show Description
tmIn21 is an inversion between pck-3 and R09H10.5 in LG IV.  Inversion strain obtained by Next-generation sequencing.
FX19134 C. elegans tmIn8 II. Show Description
Break points: In(F13D12.6 Y51H1A.2) II. Covered region (Mb) 2.1 (11.7..13.9) Obtained by TMP/UV. (Note: Y51H1A.2 has been renamed cup-14.) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19141 C. elegans atm-1(tm5027) C37A2.6(tm8115) I; Y48A6B.8(tm8116) III; xpc-1(tm3886) IV; tmIn22 V. Show Description
tmIn22 is an inversion between W02G9.9 and 21ur-15544 in LG V.  Inversion strain obtained by Next-generation sequencing.
FX19161 C. elegans dpy-20(tm5940)/tmIn5 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(mec-3 unc-31) IV. Covered region (Mb) 2.3 (10.5..12.8) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19163 C. elegans mca-3(tm6395)/tmIn11 IV. Show Description
Homozygous lethal deletion allele balanced by Unc-marked translocation. Heterozygotes are wild-type and segregate wild-type heterozygotes, lethal tm6395 homozygotes, and Unc tmIn11 homozygotes. Break points: In(kvs-5 unc-17) IV. Covered region (Mb) 2.9 (0.7..3.6) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19170 C. elegans lin-1(tm5929)/tmIn2 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(ced-2 unc-17) IV. Covered region (Mb) 2 (1.6..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
FX19171 C. elegans lig-4(tm750) III; tmIn26 X. Show Description
tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
FX19173 C. elegans lig-4(tm750) III; tmIn19 V. Show Description
Break points: In(unc-23 lon-3) V. Covered region (Mb) 3.3 (8.9..12.2) Lon Unc. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19181 C. elegans unc-15(tm6329)/tmIn14 I. Show Description
Homozygous lethal deletion allele balanced by Dpy-marked translocation. Break points: In(dpy-5 lin-10) I. Covered region (Mb) 2.7 (5.4..8.1). Pick wild-type to maintain. Heterozygotes are wild-type and segregate wild-type heterozygotes, Dpy (tmIn14 homozygotes), and unc-15 homozygotes. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19397 C. elegans tmC1 X; tmEx4487. Show Description
tmEx4487 [unc-18(+) + myo-2p::Venus]. Break points: In(F53B1.2 unc-18 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2.1..8.5) Lon Mec (Unc). Pick fluorescent non-Unc to maintain array. Males carrying the array (Venus in pharynx) can mate. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
FX19472 C. elegans tmIn10 II. Show Description
Break points: In(ZK1240.1 F29A7.8) II. Covered region (Mb) 0.4 (2.3..2.8) Obtained by TMP/UV. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19584 C. elegans lig-4(tm750) III; tmIn51 IV. Show Description
tmIn51 is a CRISPR/Cas9-induced inversion between C09G12.5 and C01B10.3 in LG IV.
FX19585 C. elegans lig-4(tm750) tmIn52 III. Show Description
Break points: In(hpr-9 ttr-52) III. Covered region (Mb) 2.8 (10.6..13.4) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19666 C. elegans tmC5 IV. Show Description
Break points: In(C01B10.3 eak-7 In(mec-3 unc-31)) IV. Covered region (Mb) 6.2 (6.6..12.8) Mec Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19668 C. elegans tmC6 [dpy-2(tmIs1189)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19702 C. elegans lig-4(tm750) III; tmIn54 V. Show Description
Break points: In(srbc-66 T10H9.8) V. Covered region (Mb) 3.1 (3.5..6.7) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19704 C. elegans tmIn58 I; lig-4(tm750) III. Show Description
Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.