Search Strains

nIs590 [fat-7p::fat-7::GFP + lin15(+)] V.  Derived by X-ray integration of waEx15. The fat-7::fat-7::GFP translational reporter is activated by 15C or acdh-11 loss-of-function. See Ma et al., Cell. 2015 May 21; 161(5): 1152–1163.

Temperature sensitive. Maintain at 15C.

Temperature sensitive. Maintain at 15C.

Temperature sensitive. Maintain at 15C. Formerly known as mat-2.

eeEx100 [his-24::GFP + rol-6(su1006)]. Rollers. Nuclear GFP fluorescence detected beginning with the eight-cell stage of the embryo in all somatic nuclei without the P-cell. In adults the GFP signal in somatic cells and in few hermaphrodites in undifferentiated germ nuclei and in oocytes and sperm. About 20% transmission.

eeEx106 [hil-1::GFP + rol-6(su1006)]. GFP expression in body wall muscles, in the vulva sex muscles, in the marginal cells of the pharynx, in a limited number of head neurons, in the cytoplasm of excretory cells. The expression starts in the about 100-cell embryo in a few cells in the periphery in the nucleoplasm and in the nucleoli. Complex extrachromosomal arrary....pick Rollers. About 20% Rollers.

Pax, Dec-slow (34" defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8.

oxEx166 [HSP::MosTRANSPOSASE + CC::GFP + lin-15(+)]. Should be grown at 25C. Maintain by picking non-Muv. Animals carrying the array should be GFP+.

oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Psoralen integration of oxEx129 [unc-49Bp(long)::GFP + lin-15(+)]. Dorsal and ventral.

At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.

oxEx110 [unc-49c::GFP + lin-15(+)]. Maintain by picking non-Muv.

oxEx166 [HSP::MosTransposase + coelomocyte::GFP + lin-15(+)]. Should be grown at 25C.

oxEx1088 [unc-17p::halorhodopsin::GFP + Litmus + lin-15(+)]. Maintain by picking wild-type.

oxEx1089 [unc-47p::halorhodopsin::GFP + Litmus + lin-15(+)]. Maintain by picking wild-type.

oxEx1578 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. [NOTE: New stock received at the CGC 03/21/12. Original stock was reported as no longer segregating Unc.]

oxEx1579 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.

oxEx1580 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.

oxEx1581 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.

oxEx1582 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. oxEx1582 array is stable; pick individual animals to obtain Uncs rather than maintaining by chunking.

oxEx1583 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.

oxEx1584 [eft-3p::GFP + Cbr-unc-119]. Pick non-Unc to maintain. Pick Unc to use for injection.

oxTi374 [unc-18(+) + ttTi5605 NeoR] V. oxEx1873 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi374 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in repressive region at position 3,339,184 of Chr V; can be used with standard ttTi5605 mosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi176 [unc-18(+) + ttTi5605 NeoR] V. oxEx1807 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi176 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in a generally permissive region at position 15,383,969 of Chr V; can be used with standard ttTi5605 mosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi173 [unc-18(+) + ttTi5605 NeoR] V. oxEx1795 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi173 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in a repressive region at position 17,523,246 of Chr V; can be used with standard ttTi5605 MosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi357 [unc-18(+) + ttTi5605 NeoR] V. oxEx1876 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi357 is a Mini-Mos insertion of ttTi5605 mosSCI landing site in a repressive region at position 20,921,413 of Chr V; can be used with standard ttTi5605 MosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

Heterozygotes are Unc and segregate Unc, non-Unc Steriles, larval lethals and dead eggs. dx19 is a strong lin-45 raf allele: dx19 homozygotes from dx19/+ heterozygous parents are 13% larval lethal and among the adults, 100% are Sterile and Vul.

Males are rayless. hlh-2(bx108) strongly and semi-dominantly enhances the ray-loss phenotype of lin-32(e1926).

V6 produces rays instead of alae in pal-1; sop-1 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx103).

V6 produces rays instead of alae in pal-1; sop01 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx107).

Paralyzed Unc. Throws males. hlh-2(bx115) has no phenotype in this background.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

Male leaving assay defective (Las), lethargic, hypereversal. Reference: Barrios, A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.

krIs14 [hsp-16.48p::MosTransposase + lin-15B + unc-122p::GFP]. GFP expression in coelomocytes. Derived by integration of oxEx166. Reference: Toraason E, et al. STAR Protoc. 2021 Sep 8;2(3):100801. doi: 10.1016/j.xpro.2021.100801. PMID: 34527958.

orEx15 [pie-1p::GFP::rfl-1(genomic) + unc-119(+)]. Pick non-Unc to maintain. pie-1 promoter-driven N-terminal GFP fusion to RFL-1. Reference: Dorfman M, et al. Genetics. 2009 Aug;182(4):1035-49.

orEx16 [rfl-1p::tdTomato::rfl-1(genomic) + unc-119(+)]. Pick non-Unc to maintain. N-terminal tdTomato fusion to RFL-1 driven by rfl-1 promoter. Reference: Dorfman M, et al. Genetics. 2009 Aug;182(4):1035-49.

itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with par-2::GFP and tubulin::GFP expression. itIs153 is an integrated derivitive of axEx1094. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.

efEx12 [glp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. GFP expression in the proliferative region of the germ line (resembling endogenous GLP-1 protein localization), and also in spermatheca and other somatic tissues. Derived by bombarding strain DP38 with LAP-tagged glp-1 fosmid (WRM0630DF02).

deEx100 [ajm-1::GFP + HinfI digested complex DNA + lin-44p::4xNLS::GFP + dpy20(+)]. Pick non-Dpy to maintain.

deEx101[dpy20(+); ajm-1::GFP; HinfI digested complex DNA; cwn-1p::4xNLSGFP]. Pick non-Dpy to maintain.

deEx102[dpy20(+); ajm-1::GFP; HinfI digested complex DNA; egl-20p::4xNLSGFP]. Pick non-Dpy to maintain.

deEx103[dpy20(+); ajm-1::GFP; HinfI digested complex DNA; cwn-2p::4xNLSGFP]. Pick non-Dpy to maintain.

deEx104 [ajm-1::GFP + mom-2p::4xNLS::GFP + dpy20(+) + HinfI digested complex DNA]. Pick non-Dpy to maintain.

zzIs16 [(pJE3) eff-1p::GFP + rol-6(su1006)]. GFP+ Rollers. Chromosomal insertion of zzEx10. Integration site of zzIs16 not yet mapped, but it is not tightly linked to eff-1 II, unc-119 III, or jcIs1 IV. pJE3 has 7.5 kb of eff-1 upstream sequence inserted into pPD95.75, driving cytoplasmic GFP expression.

zzEx10 [(pJE3) eff-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. eff-1p expression is observed in epithelia committed to fusion and in fused syncytia.

Derived by out-crossing parental strain FX18537 five times.