Search Strains

wamSi112 [eft-3p::mScarlet::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mScarlet from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

wamSi118 [eft-3p::mCerulean3::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mCerulean3 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

wamSi123 [eft-3p::mECitrine::unc-54 3'UTR + Cbr-unc-119 (+)] V. Expresses a single copy of mECitrine from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

wamSi3 [eft-3p::mNeptune::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mNeptune from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

wamSi6 [eft-3p::mTagBFP2::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mTagBFP2 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

wamSi7 [eft-3p::mTagRFP-T::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mTagRFP-T from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

Phenotypically WT. F3.2 See also WBPaper00005927.

Superficially wild-type. Antibody staining required to observe phenotype. Contains at least one extraneous mutation in the background (Eur. Worm Mtg 2006, Venuz et al.).

No visible phenotype. Whole genome sequenced strain. Reference: Grenache DG, et al. Proc Natl Acad Sci U S A. 1996 Oct 29;93(22):12388-93.

kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4).

kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons.

zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced heterozygotes are Unc and segregate Unc (heterozygotes), Rol Par (sqt-3 par-1 homozygotes; maternal effect lethal), and dead eggs (nT1 homozygotes). NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK288. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.

zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Temperature-sensitive maternal-effect lethal. Maintain at 15C. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and EU822. Unknown if unc-119(ed3) is still present or homozygous in background. NOTE: this strain was originally described as heterozygous for lin-2(e1309), but lin-2 has been lost; this strain is now homozygous wild-type for lin-2. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.

zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Pick wild-type to maintain. Worms carrying the sDp3 duplication are wild-type; animals that have lost the duplication are Lon Par (maternal effect lethal). Cross of JJ1473 and KK237. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.

zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced worms are wild-type and segregate wild-type (heterozygotes), Coil Par (par-6 unc-101 homozygotes; maternal effect lethal), and paralyzed Unc (hIn1 homozygotes). Par phenotype is slightly leaky, but survivors are agametic. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK818. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.

zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Heterozygous worms are wild type and segregate wild type, Par (maternal effect lethal), and Dpy (sC1 homozygotes). Heterozygous and Par adults are indistinguishable on the plate. Maintain by picking wild-type worms and checking for correct segregation of progeny. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and VC1313. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.

goeIs3 [myo-3p::SL1::GCamP3.35::SL2::unc-54 3'UTR + unc-119(+)]. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator cytosolic GCaMP3 and mitochondrial LAR-GECO in all body wall muscles.

agIs17 [myo-2p::mCherry + irg-1p::GFP] IV. GFP in pharynx and intestine that turns on upon infection with pathogenic Pseudomonas aeruginosa strain PA14. Reference: Dunbar TL, et al. Cell Host Microbe. 2012 Apr 19;11(4):375-86.

Enhanced susceptibility to pathogens (Esp). Nsy. Egl-d. Also called esp-8.

agIs219 [T24B8.5p::GFP::unc-54 3' UTR + ttx-3p::GFP::unc-54 3' UTR] III. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.

Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile tm2223 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.

[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010.

GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. Expressed primarily in both male and hermaphrodite gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.

Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.

Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.

The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544. doi: 10.1016/j.celrep.2023.112544. PMID: 37227820. .

viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.

vizIs23 [pie-1p::GFP::daf-2(WT)::pie-1 3'UTR + unc-119(+)]. Maintain at 15C; pick superficially wild-type animals to avoid silencing of the transgene. pie-1 driven DAF-2 coding region with GFP transgene rescues the germline defects of daf-2(e1370). Slow growing. The transgene is sometimes silenced in the germline resulting in dauerunc animals at 25C. Reference: Lopez AL 3rd, et al. Dev Cell. 2013 Oct 28;27(2):227-40.

vizSi20 [mex-5p::GFP::gsk-3 (K65A,E77A,D161A,D180A)::tbb-2 3’UTR + unc-119(+)] II. Superficially wild-type. vizSi20 was inserted into Chr II ttTi5605 using MosSci. GSK-3 cDNA was rendered kinase dead by replacing K65, E77, D161 and D180 to alanine. The transgene does not rescue gsk-3 sterility or embryonic lethality defects. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.

vizSi32 [cdk-2p(intron)::GFP::tbb-2 3’ UTR + unc-119(+)] II. vizSi32 was inserted into ttTi5605 on Chr II using MosSci. Intron 1 of cdk-2 drives drives GFP expression in this transgene. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.

vizSi34 [cdk-2p::GFP::tbb-2 3’ UTR + unc-119(+)] II. Superficially wild-type. vizSi34 was inserted into ttTi5605 on Chr II using MosSci. Predicted cdk-2 promoter (from WormBase) drives GFP expression. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.

Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc mre-11 homozygotes, and dead eggs (nT1 homozygotes). mre-11 homozygotes produce about 200 fertilized eggs but only about 2-3% of these eggs survive to adulthood (this mutation cannot be maintained in a homozygous condition). Occasionally non-Unc progeny that do not demonstrate the mre-11(ok179) mutant phenotype arise when grown in large liquid cultures. mre-11 is the predicted gene ZC302.1

Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc msh-5 homozygotes, and dead eggs (nT1 homozygotes). msh-5 homozygotes give 97.9% dead eggs; of those that hatch, 42% are male.

Heterozygotes are wild type with a green pharynx. They segregate Dpy, green pharynx, tmC18 homozygotes, and sterile, non-green pharynx, dao-5 homozygotes.

meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1.

Heterozygotes are WT and GFP+. Segregate syp-3(me42) homozygotes that are non-GFP and lay mostly dead eggs; these mutants form abnormal synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable.

Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc him-3(me80) homozygotes, and dead eggs (nT1 homozygotes). him-3(me80) homozygotes are viable and non-Unc. They produce more than 85% dead eggs and a large fraction (11%) of the survivors are males (Him phenotype). Cytologically they exhibit a reduced level of HIM-3 loading and fewer stretches of SYP-1 than WT. In diakinesis-stage oocytes, they contain a mixture of bivalents and univalents. Maintain by picking Unc.

Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs.

Produces 32% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf3 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf3/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf3 can be followed in heterozygotes by this weak Him phenotype.

qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok197 homozygotes (viable, sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. rad-50 homozygotes are viable, produce more than 95% dead eggs and a large fraction of the survivors are male (Him phenotype). Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Reference: Hayashi M, et al. PLoS Genet. 2007 Nov;3(11):e191.

Age-dependent defect in meiotic double-strand break formation. Homozygous mutants produce elevated frequency of males and dead embryos resulting from defects in meiotic chromosome segregation. The frequency of both males and dead embryos increases in later broods. Reference: Rosu S, et al. PLoS Genet. 2013;9(8):e1003674.

krIs14 [hsp-16.48p::MosTransposase + lin-15B + unc-122p::GFP]. Heterozygotes are WT with GFP (GFP+ coelomocytes & GFP+ pharynx), and segregate WT GFP, arrested nT1[qIs51] aneuploids, and Dpy Unc homozygotes (GFP+ pharynx & GFP+ coelomocytes). Homozygous nT1[qIs51] inviable. Pick WT with GFP (GFP+ pharynx & GFP+ coelomocytes) and check for correct segregation of progeny to maintain. References: Robert V & Bessereau JL. EMBO J. 2007 Jan 10;26(1):170-83. doi: 10.1038/sj.emboj.7601463. PMID: 17159906. Rosu S, et al. Science. 2011 Dec 2;334(6060):1286-9. doi: 10.1126/science.1212424. PMID: 22144627. Toraason E, et al. Elife. 2024 Aug 8;13:e80687. doi: 10.7554/eLife.80687. PMID: 39115289.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Reference: Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.

Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. Reference: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452.

artEx27 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion. Broad pattern of developmental GFP expression in the intestine, hypodermal seam cells, and neurons. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.

artEx12 [hpk-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Transcriptional fusion of hpk-1 promoter with GFP. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.

gpIs1 [hsp-16.2p::GFP]. artEx35 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick animals with red pharynx to maintain. Inducible GFP fluorescence after >1 hour heat shock. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.

artEx31 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick mCherry+ animals to maintain. sur-5 driven over-expression of hpk-1. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.