Search Strains

Y106G6A.2. Homozygous. Outer Left Sequence: TTCGGCTGACATGAAGACTG. Outer Right Sequence: CTTCAACAGCAAATGCCTGA. Inner Left Sequence: CGAAGGGTATGGGGAGAAAT. Inner Right Sequence: GGGGAACGAAACCCATAAGT. Inner Primer PCR Length: 2400 bp. Deletion Size: 1281 bp. Deletion left flank: GTGCGCCTTTAGAGTACTTTAGTTTCAAAC. Deletion right flank: AACCGGGTTATTGTCGATTCAATATTCATG. [NOTE (11-18-2015) A user has reported that this strain was heterozygous for ok2561 by PCR analysis.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.14. Homozygous. Outer Left Sequence: CAGCATCCGAGTCTGACAAA. Outer Right Sequence: GACCGTCTTCGTCCATCATT. Inner Left Sequence: TTCAGCATACTCTTCTTCATTCAC. Inner Right Sequence: GCGGACCGTTGACTTTCTAT. Inner Primer PCR Length: 1296 bp. Deletion Size: 333 bp. Deletion left flank: TCAACAACGTATCCACTGCTGGCGCGTGTC. Deletion right flank: TAAAAACTGTAAAACCATGTGAATTAATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6E.4 Homozygous. Outer Left Sequence: cacctcggaaggctagaatg. Outer Right Sequence: ccgatccctgacgatatcaa. Inner Left Sequence: tcacaaaaccatttgaggaatg. Inner Right Sequence: ggcaaaacatttccatgtgc. Inner Primer PCR Length: 1244. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.14. Homozygous. Outer Left Sequence: CAGCATCCGAGTCTGACAAA. Outer Right Sequence: GACCGTCTTCGTCCATCATT. Inner Left Sequence: TTCAGCATACTCTTCTTCATTCAC. Inner Right Sequence: GCGGACCGTTGACTTTCTAT. Inner Primer PCR Length: 1296 bp. Deletion Size: 381 bp. Deletion left flank: GCTGTAAGTATTCACCATAATTAGCTGGAA. Deletion right flank: CCGTTTATTAGCTATTTGACAGAGAAATTT. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.11 Homozygous. Outer Left Sequence: accgctaggattttcggatt. Outer Right Sequence: gcccctgagttgcaaaatta. Inner Left Sequence: tggtattcggtatcaggagca. Inner Right Sequence: gcctctttcctgtgcacttt. Inner Primer PCR Length: 1282. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.3 Homozygous. Outer Left Sequence: tggtcaagaacgtgctgaag. Outer Right Sequence: cagatcggcaattcggtaat. Inner Left Sequence: atcaaaccgtaacgggacag. Inner Right Sequence: tcagcagttatccaactccaaa. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6G.2 Homozygous. Outer Left Sequence: cccatacgtactcggagcat. Outer Right Sequence: aatagctctgcaccggaaga. Inner Left Sequence: cttccagcacgaagaagcat. Inner Right Sequence: tgcaacgagaagatcgagtg. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygotes Dpy and unhealthy. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Dpy adults (ve662 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: agaagaaacaaagaaatcccaaaaaaaaaa ; Right flanking sequence: Tatccgattattacagtattaaattctatc. sgRNA #1: aagaaaaaagaaacggtata; sgRNA #2: actgtaataatcggatATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3949 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaaatccaaaaaaaactcacCGGCAAATA ; Right flanking sequence: GTCAGCTCGATCCGTGTCAGCTGTCTCGAA. sgRNA #1: aaaactcacCGGCAAATATT; sgRNA #2: ACACGGATCGAGCTGACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

uthSi17 [myo-3p::MLS::GFP::unc-54 3’UTR + Cbr-unc-119(+)] I. Single-copy insertion. MLS::GFP reporter uses myo-3 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in body-wall muscle cells. Derived by out-crossing parental strain AGD1664 (EG6701 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.

uthSi83 [col-19p::MLS::GFP(65C)::unc-54 3'UTR + Cbr-unc-119(+)] I. Single-copy insertion. MLS::GFP reporter uses col-19 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in hypodermal cells beginning in late L4 stage. Derived by out-crossing parental strain AGD2837 (EG6701 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.

uthSi80 [vha-6p::MLS::GFP(65C)::unc-54 3'UTR + Cbr-unc-119(+)] IV. Single-copy insertion. MLS::GFP reporter uses vha-6 promoter and atp-1 mitochondrial localization sequence; localizes to mitochondrial matrix in intestinal cells. Derived by out-crossing parental strain AGD2805 (EG6703 background) to N2. Reference: Kim J, et al. J Vis Exp. 2025 Jan 17:(215). doi: 10.3791/67610. PMID: 39895615.

stIs10532 [Y106G6H.4::H1-wCherry + unc-119(+)].

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10582 [Y106G6H.4::H1-wCherry + unc-119(+)].

eGFP and 3xFLAG tags inserted into endogenous locus by CRISPR/Cas9.

ustSi106 [wago-1p::3xFlag::GFP::wago-1::wago-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.

GFP::3xFlag inserted into endogenous erh-2 locus using CRISPR/CAS9 engineering. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.

ustSi55 [pid-1p::pid-1::GFP::3xFlag::pid-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.

GFP::3xFlag inserted into endogenous ife-3 locus using CRISPR/CAS9 engineering. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.

Bacteria. E. coli carrying pAG607 (orn-1 RNAi feeding vector) for SILAC. Arg-, Lys-, AmpR, TetR. argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rnc14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase). Resistant to ampicillin and tetracycline. Reference: Larance M, et al. Nat Methods. 2011 Aug 28;8(10):849-51. Biosafety Level: BSL-1.

iowSi8 [pie-1p::GFP1-10::him-3 3’UTR + Cbr-unc119(+)] II. Germline-specific split-GFP construct. If germline silencing occurs, transgene expression can be recovered by growing worms at 25C for 2 generations. iowSi8 was generated by MosSCI insertion into Chr II ttTi5605 in parental strain EG6699. Reference: Hefel A & Smolikove S. G3. 2019 Jun 5;9(6):1933-1943. PMID: 30992318.

prp-8(az29) is a G654E missense mutation. az29 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). It changes cryptic splicing of e936 to allow for an increase in full-length unc-73 expression. Reference: Mayerle M, et al. Proc Natl Acad Sci U S A. 2019 Feb 5;116(6):2193-2199. doi: 10.1073/pnas.1819020116. PMID: 30674666.

ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.

texIs127 [spp-9p::GFP] X. GFP expression in intestine and six aphid neurons, including AWB and AWC, serves as a reporter for DBL-1 signaling (fluorescence is high when DBL-1 signaling is low, and low when DBL-1 signaling is high). This reporter is also responsive to starvation, select bacterial pathogens, and loss of other innate immune signaling pathways, including tir-1 and pmk-1 (but not sek-1 or mek-1). texIs127 created by X-ray integration of extrachromosomal array wkEx52 into N2 animals using UV/TMP. Out-crossed five times to the N2. References: Lakdawala ML, et al. Mol Biol Cell. 2019 Dec 15;30(26):3151-3160. doi: 10.1091/mbc.E19-09-0500. PMID: 31693440. Roberts AF, et al. 2010 Jun 7:10:61. doi: 10.1186/1471-213X-10-61. PMID: 20529267.

Y47G6A.24, Y47G6A.25. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1536 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1656 homozygotes (probable early larvarl arrest ). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTTTGCGATTCATTTCA. External right primer: CTAGACGTCGCCTGACTTCC. Internal left primer: GTTCAACATGTGTTGGTCCG. Internal right primer: GACCCAACTCCTCACCCATA. Internal WT amplicon: 2732 bp. Deletion size: 1938 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.23. External left primer: AAGAAGCTGCTGGCCAATAA. External right primer: TGGAACTCTTCCAATTTCCG. Internal left primer: TGTTTCGGTCTAAACGAGGC. Internal right primer: TCAGTGAAGTGGCGATTGAG. Internal WT amplicon: 3251 bp. Deletion size: 1913 bp. Deletion left flank: GACTGTTGGGTTACTGTAGTGGTATTGTGG. Deletion right flank: AGTACCCTTTAAAGGTGCACGCCTTTTTTC. Insertion Sequence: GAGTAATTCTTTTTTTTTCGCGTAGCCAACAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6E.4. External left primer: CACCTCGGAAGGCTAGAATG. External right primer: CCGATCCCTGACGATATCAA. Internal left primer: TCACAAAACCATTTGAGGAATG. Internal right primer: GGCAAAACATTTCCATGTGC. Internal WT amplicon: 1245 bp. Deletion size: 369 bp. Deletion left flank: TACAGCCTTCATGTCTAGGGGCCTACTTTA. Deletion right flank: TTCATAAACTGCCTGAGCTCTGATTTTACC. Insertion Sequence: TTCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.14. Identified by PCR, validated by CGH. External left primer: GGATGCTAGTTTGGAGAGCG. External right primer: AACAGCTGACAAGGAGCGAT. Internal left primer: GTGAACCATCCGATTATGCC. Internal right primer: AATTCGAGAAGAACGATGCG. Internal WT amplicon: 1747 bp. Deletion size: 767 bp. Deletion left flank: CGTTATTCAGCCGCAAAATTAGAGAAATCT. Deletion right flank: AGACATTCAGCCAGCATATCCATATTTCCA. Insertion Sequence: CGACTTTCGCGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2187 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAGCCTTTTGAGAAACACG. External right primer: CATAAGAAAGCTTCGCAGGC. Internal left primer: CCCTGCCACTGTGACAATTA. Internal right primer: GGAGCCAAATGGAAGAAACA. Internal WT amplicon: 3170 bp. Deletion size: 1128 bp. Deletion left flank: ATACTGCCTGTGCGACTCCAAATGCCAACT. Deletion right flank: AGTTTTTCAGAAATTAAAAAACCTTTATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.5. External left primer: TAGGGAATATCGATCGGCTG. External right primer: CGCGTCAATCATGGTGTATC. Internal left primer: TTCAACTACCGTAGCCGAGG. Internal right primer: GATCCGAAATGAATAACCGC. Internal WT amplicon: 1768 bp. Deletion size: 720 bp. Deletion left flank: CTCCACCACTTCGTCCGTCTACACAATCAG. Deletion right flank: CATCATATCCTACGCGCAATTTTCAAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.5, K02B9.1, K02B9.3. External left primer: TAGGGAATATCGATCGGCTG. External right primer: CGCGTCAATCATGGTGTATC. Internal left primer: TTCAACTACCGTAGCCGAGG. Internal right primer: GATCCGAAATGAATAACCGC. Internal WT amplicon: 1768 bp. Deletion size: 371 bp. Deletion left flank: TAACATTTCGCGGCATCCATCAGCAACTTC. Deletion right flank: GCAACTTTTTCAAAATTAAAAAAAAACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.28. Mildly Unc, lethargic. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807. nefr-1 formerly known as tag-63.

Y106G6H.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3566 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. xternal left primer: CCAAAAACCGGAAAAAGACA. External right primer: AAAAACGTCCGATGCAATTC. Internal left primer: AGTGTTTCAAGGGAGGAGGG. Internal right primer: TCCATCCGTGACATCGTTTA. Internal WT amplicon: 1153 bp. Deletion size: 474 bp. Deletion left flank: ATTAGAAGTTCACGCAGTTATTTTTTCTAT. Deletion right flank: CTACAACGGAAACAACATTGAGCTCGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 3766 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CCCTCTTCAGAGCGTAGGTGGATATTGGTG. Right flanking sequence: AACATTTTGAAATACGTTTCAACAATAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Temperature sensitive: maintenance at 15-20C. Reduced number of progeny at elevated temperatures. PH domain added to the 3xFLAG::GFP-tagged endogenous wago-4 locus in parental strain YY1325. This allele localizes WAGO-4 to the plasma membrane, but de-localization is not complete (some residual germ granule signal is detected).

Temperature sensitive: maintain at 15-20C. Reduced number of progeny and mortal germline phenotype at elevated temperatures. Mitochondria Targeting Sequence (mts) added to the 3xFLAG::GFP-tagged endogenous wago-4 locus localizes tagged WAGO-4 to mitochondria. This allele was introduced into 3xFlag::GFP tagged endogenous wago-4 locus in parental strain YY1325.

Temperature sensitive: maintain at 15-20C. Reduced number of progeny at elevated temperatures. wago-4(jog272) is an engineered Y611E point mutation predicted to disrupt small RNA binding and exhibits a diffuse cytoplasmic localization. This allele was introduced into 3xFlag::GFP tagged endogenous wago-4 locus in parental strain YY1325.

3xflag::gfp inserted into endogenous wago-4 locus using CRISPR/Cas9 engineering. 3xFLAG::GFP::WAGO-4 is partially functional in this strain. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.

HA::tagRFP inserted into endogenous znfx-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.

gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.

Nuclear RNAi defective. Reference: Guang et al., Science 321(5888):537-41 (2009).

Nuclear RNAi defective. Reference: Guang et al., Science 321(5888):537-41 (2009).

iaIs21 [gcy-35p::GFP + unc-119(+)]. gcy-35::GFP is expressed in fifteen neurons, all of which also express ahr-1: AQR, PQR, URXR/L, ALNL/R, BDUL/R, SDQL/R, PLML/R, AVM, and two neurons in the tail tentatively identified as PLNL/R. gcy-35::GFP is only transiently expressed in PLML/R during the first larval stage.

iaIs25 [gcy-37p::GFP + unc-119(+)]. gcy-37::GFP is consistently expressed in AQR, PQR, URXL. and URXR neurons. Expression also observed in AVM and two unidentified neurons located in the head.

iaIs19 [gcy-32p::GFP + unc-119(+)]. Expression of gcy-32::GFP is consistenly observed in AQR, PQR, and URX neurons.

iaIs22 [gcy-36p::GFP + unc-119(+)]. gcy-36::GFP is consistently expressed in AQR, PQR, URXL and URXR neurons.

iaEx101 contains [egl-9p::egl-9(H487A)::tag + unc-119(+)]. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).