Search Strains

More Fields
Strain Species Genotype Add
CG644 C. elegans pha-1(e2123) III; him-5(e1490) V; rgEx251. Show Description
rgEx251[pha-1(+) + osm-12 promoter:: unc-103(gf)]. Maintain at 20C.
CSG60 C. elegans gsgIs3 II. Show Description
gsgIs3 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (II: 9834540). Superficially wild-type. gsgIs3 can be used to generate single-copy insertions in C. elegans Chromosome II. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.
DG627 C. elegans emb-30(tn377) III. Show Description
Temperature sensitive. Maintain at 15C. Male mating stock.
DG695 C. elegans +/hT2 [dpy-18(h662)] I; unc-36(e251) evl-8(ar102)/hT2 [bli-4(e937)] III. Show Description
Heterozygotes are WT and segregate WT, Uncs with an everted Vulva, Dpys and dead eggs.
DG696 C. elegans +/hT2 [dpy-18(h662)] I; unc-36(e251) evl-19(ar98)/hT2 [bli-4(e937)] III. Show Description
Heterozygotes are WT and segregate WT, Uncs with an everted Vulva, Dpys and dead eggs.
DM7275 C. elegans pha-1(e2123) III; raEx275. Show Description
raEx275 [T05G5.1p::Y106G6A.1(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DN20 C. elegans nhr-6(lg6001) III. Show Description
Homozygotes have defective spermatheca development causing low brood size, abnormally shaped eggs, and occasional Egl. nhr-6(lg6000) allele was originally generated by Marius Hoener and Tri Nguyen.
EG4322 C. elegans ttTi5605 II; unc-119(ed9) III. Show Description
Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]
EG5003 C. elegans unc-119(ed3) III; cxTi10882 IV. Show Description
Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).
EG6032 C. elegans ttTi4348 I; unc-18(md299) X. Show Description
Unc. MosSCI insertion strain with unc-18 marker instead of unc-119. Mos1 insertion in Chr I. Compatible with mosSCI targeting vectors pCFJ448 (Gateway) and pCFJ676 (MCS).
EG6053 C. elegans oxSi212 II; unc-119(ed3) III. Show Description
oxSi212 [pie-1p::GFP::mCherry::H2B::gld-2 3'UTR::operonGFP::H2B::cye-1UTR] II. Maintain under normal conditions; expression is stable. Superficially wildtype. Bright, nuclear mCherry and GFP fluorescence in germline. Reference: Frokjaer-Jensen C, et al. Nat Methods. 2012 Jan 30;9(2):117-8.
EG6070 C. elegans oxSi221 II; unc-119(ed3) III. Show Description
oxSi221 [eft-3p::GFP + Cbr-unc-119(+)] II. Broad, bright GFP fluorescence clearly visible on dissection scope. Single copy insert into MosSCI site ttTi5605 on Chr. II. Can be used as balancer.
EG6109 C. elegans unc-119(ed3) III; oxSi230 X. Show Description
oxSi230 [eft-3p::GFP + Cbr-unc-119(+)] X. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi14024 on Chr. X. Can be used as balancer.
EG6142 C. yunquensis Show Description
Caenorhabditis sp. 19 Male-female strain. Isolated from a rotten fruit/seed of Ausubo (Manilkara dentata) collected by Susan Dalton in El Yunque, Puerto Rico, near El Verde (~18.3°N, 65.8°W), around March 28, 2010.
EG6171 C. elegans oxSi257 I; unc-119(ed3) III. Show Description
oxSi257 [eft-3p::GFP + Cbr-unc-119(+)] I. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi4391 on Chr. I. Can be used as balancer.
EG6173 C. elegans oxSi259 I; unc-119(ed3) III. Show Description
oxSi259 [eft-3p::GFP + Cbr-unc-119(+)] I. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site ttTi4348 on Chr. I. Can be used as balancer.
EG6250 C. elegans unc-119(ed3) III; cxTi10882 IV. Show Description
Unc. Not caused by cxTi10882. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). Grows best on HB101 bacteria. Reference: Frokjaer-Jensen C, et al., Nat Genet. 2008 Nov;40(11):1375-83.
EG6401 C. elegans unc-119(ed3) III; oxSi346 IV. Show Description
oxSi346 [eft-3p::GFP + Cbr-unc-119(+)] IV. Broad, bright GFP fluorescence. Clearly visible on dissection scope. Single copy insert into MosSCI site cxTi10816 on Chr. IV. Can be used as balancer.
EG6629 C. elegans oxIs565 II; oxTi80 III; oxSi199 IV. Show Description
oxIs565 [dpy-30p::frt::mCherry::frt::GFP::H2B + Cbr-unc-119(+)] II. Ubiquitous mCherry expression. Green nuclei after FLP activity. Integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Combined fluorescent balancer strain for LG II, LG III and LG IV.
EG6699 C. elegans ttTi5605 II; unc-119(ed3) III; oxEx1578. Show Description
oxEx1578 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. [NOTE: New stock received at the CGC 03/21/12. Original stock was reported as no longer segregating Unc.]
EG6700 C. elegans unc-119(ed3) III; cxTi10882 IV; oxEx1579. Show Description
oxEx1579 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.
EG6701 C. elegans ttTi4348 I; unc-119(ed3) III; oxEx1580. Show Description
oxEx1580 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.
EG6702 C. elegans ttTi4391 I; unc-119(ed3) III; oxEx1581. Show Description
oxEx1581 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.
EG6703 C. elegans unc-119(ed3) III; cxTi10816 IV; oxEx1582. Show Description
oxEx1582 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection. oxEx1582 array is stable; pick individual animals to obtain Uncs rather than maintaining by chunking.
EG6704 C. elegans unc-119(ed3) III; ttTi44501 X; oxEx1583. Show Description
oxEx1583 [eft-3p::GFP + Cbr-unc-119(+)]. Pick non-Unc to maintain. Pick Unc to use for injection.
EG6705 C. elegans unc-119(ed3) III; ttTi14024 X; oxEx1584. Show Description
oxEx1584 [eft-3p::GFP + Cbr-unc-119]. Pick non-Unc to maintain. Pick Unc to use for injection.
EG6787 C. elegans oxSi487 II; unc-119(ed3) III. Show Description
oxSi487 [mex-5p::mCherry::H2B::tbb-2 3'UTR::gpd-2 operon::GFP::H2B::cye-1 3'UTR + unc-119(+)] II. MosSCI insertion into ttTi5605 site on Chr II. unc-119 rescue, bright nuclear GFP and nuclear mCherry fluorescence in germline.
FX19120 C. elegans atm-1(tm5027) Y47G6A.28(tm7889) nepr-1(tm7890) I; C18H9.6(tm7891) II; xpc-1(tm3886) tmIn21 IV; srh-54(tm7892) V. Show Description
tmIn21 is an inversion between pck-3 and R09H10.5 in LG IV.  Inversion strain obtained by Next-generation sequencing.
GG60 C. elegans glp-1(g60) III. Show Description
Accumulates dead eggs at permissive temperature (15C). Will grow at 20C, but not at 25C. g60 pka emb-33.
GG62 C. elegans emb-34(g62) III. Show Description
Temperature sensitive-maintain at 15C. Some growth at 20C. Does not grow at 25C.
GG64 C. elegans emb-35(g64) IV. Show Description
Temperature sensitive. Maintain at 15C. Embryonic lethal at 25C.
GG65 C. elegans emb-5(g65) III. Show Description
Temperature sensitive. Maintain at 15C. Will grow at 20C, but not at 25C.
GR2260 C. elegans cdo-1(mg622) X. Show Description
Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR2263 C. elegans nhr-45(mg641) X. Show Description
Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.
GR3055 C. elegans suox-1(mg663)/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X Show Description
Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
IG685 C. elegans tir-1(tm3036) III. Show Description
Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105.
IG692 C. elegans tir-1(tm3036) III; frIs7. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105.
IP1001 C. elegans nhr-6(lg6001)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous nhr-6(lg6001) mutants have defective spermatheca development causing low brood size, abnormally shaped eggs, and occasional Egl. Heterozygotes are WT and segregate WT, semi-sterile WT, and Sterile Dpys.
JMC164 C. elegans csr-1(tor67[csr-1 exon2::GFP::FLAG IV:7958598]csr- 1(mg660[G120*]) IV) IV . Show Description
Null allele of csr-1 with GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus. tor67 would normally tag both long and short isoforms, but the mg660 allele introduces a stop codon into the first exon so the long isoform is not made and only tagged CSR-1B isoform is produced.
JMC245 C. elegans alg-4(tm1184) III; csr-1(tor67[csr-1 exon2::gfp::3xflag (IV:7958598)], csr-1(mg660[G120*])) alg-3(tm1155) IV; wago-10(tor133) V. Show Description
Quadruple mutant of four spermatogenesis-specific ago genes. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
MAD63 C. elegans dqSi1 II; unc-119(ed3) III. Show Description
dqSi1 [mex-5p::atx-2a(cDNA)::GFP::tbb-2 3’UTR + unc-119(+)] II. Made by injection into strain EG6699; insertion confirmed by sequencing. dqSi1 rescues atx-2(ne4297). Reference: Gnazzo MM, et al. Mol Biol Cell. 2016 Oct 15;27(20):3052-3064. (PMID: 27559134) Del Castillo U, et al. Traffic. 2019 Jun;20(6):436-447. (PMID: 30989774)
MG617 C. elegans xsSi5 II. Show Description
xsSi5 [pie-1p::GFP::ani-1(AH+PH)::pie-1 3'UTR + Cbr-unc-119(+)] II. The RhoA biosensor consists of GFP fused to the C-terminal portion of C. elegans anillin, which contain its conserved region (AH) and pleckstrin homology (PH) domain. It lacks the N-terminal myosin- and actin-binding domains but retains its RhoA-binding domain. [NOTE: xsSi5 was originally published as mgSi5.] References: Tse YC, et al. Mol Biol Cell. 2012 Oct;23(20):4020-31.
MG685 C. elegans xsSi43 II; unc-119(ed3) III. Show Description
xsSi43 [cyk-4p::cyk-4::GFP::pie-1 3'UTR + Cbr-unc-119(+)] II. CYK-4::GFP fusion protein expressed in germline and embryo. [NOTE: previously published as mgSi43.] Reference: Zhang D & Glotzer M. Elife. 2015 Aug 7;4.
OG636 C. elegans drSi41 II; unc-119(ed3) III. Show Description
drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG646 C. elegans hsf-1(sy441) I; drSi41 II. Show Description
drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi41 in hsf-1(sy441) hypomorph. drSi41 includes hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
PS7833 C. elegans Y106G6H.8(sy1076) I. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of Y106G6H.8 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATCTCCCCACCAAGTGTCGATATGTCTCCAATT; right flanking sequence: ATTCGTCTGGCTGGCCTCTCGGGAGCTGTTGCCATTTC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
QG1 C. elegans qgIR1 (X, CB4856>N2) X. Show Description
qgIR1 (X, CB4856>N2, haw102573 to 4,822,488) X. The strain is a nearly isogenic line that carries the CB4856 version of npr-1 in an otherwise N2 genetic background. NIL derived from RIAIL QX58 linked then unlinked to mec-2 from CB3273 lon-2 mec-2, then backcrossed to lon-2 for 12 generations selecting nonLon worms, then homozygosed. Genotyped N2 at pkP6106 and pkP6145. Based on QG613 sequencing, interval is from X:4,754,307-4,864,273.
RB1117 C. elegans Y47G6A.14(ok1106) I. Show Description
Y47G6A.14 Homozygous. Outer Left Sequence: aggtgtcaagaagagccgaa. Outer Right Sequence: cctccttgagacttgaagcg. Inner Left Sequence: cttgagcgaggtgtaggctt. Inner Right Sequence: gccaggaagaatttggtgaa. Inner Primer PCR Length: 3237. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1720 C. elegans Y106G6A.1(ok2178) I. Show Description
Y10G6A.1. Homozygous. Outer Left Sequence: GGCATCTTCCCATTCGAGTA. Outer Right Sequence: GAGTCATCGGTTACCGTCGT. Inner Left Sequence: CCTGTGCTCAACTCTGCTTG. Inner Right Sequence: TAAATTCGAATGGCGGTCTC. Inner Primer PCR Length: 2210 bp. Deletion Size: 1007 bp. Deletion left flank: GTTTTAAATATTATTTTTACCGTAAAATTC. Deletion right flank: AAGTTTGTTCAATGTTTTGAAAACCGTAGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1929 C. elegans inx-21(ok2524) I. Show Description
Y47G6A.1. Homozygous. Outer Left Sequence: AAAGTGGCACCGAGAAGTTG. Outer Right Sequence: TCAACGAACTCGAATCATCG. Inner Left Sequence: CTCGCCTCAAAACCAATGTT. Inner Right Sequence: CGTCGATACTGTGGAACGAG. Inner Primer PCR Length: 3086 bp. Deletion Size: 1960 bp. Deletion left flank: ATATTATGGGGACGCAGAAAAATTCGCATT. Deletion right flank: CTAATTTTGTTTATATTGATGAGAAAACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807