More Fields
Strain Species Genotype
ABR1 C. elegans pha-1(e2123) III; staEx1. Show Description
staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.
BA1 C. elegans fer-1(hc1) I. Show Description
Temperature sensitive. M-MATING+LOW TEMP ONLY. Recessive. Fertilization abnormal.
BB1 C. elegans dcr-1(ok247)/unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT heterozygote, Uncs (unc-32 homozygotes), and Steriles (dcr-1 homozygotes).
BB21 C. elegans adr-1(tm668) I; adr-2(ok735) III. Show Description
Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.
BB239 C. elegans adr-1(uu49) I; adr-2(uu28) III. Show Description
Chemotaxis deficient. Transgenes are silenced in this background. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. NOTE: In the referenced publication, irregularities were noted in the adr-1(gv6);adr-2(gv42) null strain, which were ascribed to background mutationsint hat strain. This strain -- adr-1(uu49);adr-2(uu28) -- was generated Crispr/Cas9 targeted mutation and phenotypes are more consistent with another null strain, adr-1(tm668);adr-2(ok735).
BB242 C. elegans adr-1(uu49) I; adr-2(uu28) III; rde-1(uu51) V. Show Description
RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
BB244 C. elegans adr-1(uu49) I; adr-2(uu28) rde-4(uu53) III. Show Description
RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
BB259 C. elegans adr-1(uu49) I; adr-2(uu28) III; ggIs1 IV. Show Description
ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
BB261 C. elegans adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III. Show Description
Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
BB270 C. elegans adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III; rde-1(uu51) V. Show Description
RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
BB272 C. elegans adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) rde-4(uu53) III. Show Description
RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
BB278 C. elegans adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III; ggIs1 IV. Show Description
ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
BB283 C. elegans adr-1(uu49) I; adr-2(uu28) III; ergo-1(uu68) V. Show Description
Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
BC10154 C. elegans dpy-5(e907) I; sEx10154. Show Description
sEx10154 [rCes T05B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10495 C. elegans dpy-5(e907) I; sEx10495. Show Description
sEx10495 [rCesT22B11.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10751 C. elegans dpy-5(e907) I; sEx10751. Show Description
sEx10751[rCesC44B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11336 C. elegans dpy-5(e907) I; sEx11336. Show Description
sEx11336 [rCesT10B11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13375 C. elegans dpy-5(e907) I; sEx13375. Show Description
sEx13375 [rCesY53C12B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13608 C. elegans dpy-5(e907) I; sEx13608. Show Description
sEx13608 [rCesC52B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13886 C. elegans dpy-5(e907) I; sEx13886. Show Description
sEx13886 [rCes T01B11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13898 C. elegans dpy-5(e907) I; sEx13898. Show Description
vsEx13898 [rCesC08B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14395 C. elegans dpy-5(e907) I; sEx14395. Show Description
sEx14395 [rCesY17G7B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14673 C. elegans dpy-5(e907) I; sIs13886. Show Description
sIs13886 [rCes T01B11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14775 C. elegans dpy-5(e907) I; sEx14775. Show Description
sEx14775 [rCesY44A6B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14946 C. elegans dpy-5(e907) I; sEx14946. Show Description
sEx14946 [rCes C45B11.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14978 C. elegans dpy-5(e907) I; sEx14978. Show Description
sEx14978 [rCes T10B11.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15236 C. elegans dpy-5(e907) I; sEx15236. Show Description
sEx15236 [rCesW06B11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15553 C. elegans dpy-5(e907) I; sEx15553. Show Description
sEx15553 [rCes Y73C8B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15761 C. elegans dpy-5(e907) I; sEx15761. Show Description
sEx15761[rCesF55B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15868 C. elegans dpy-5(e907) I; sEx15868. Show Description
sEx15868 [rCesY47G7B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BE1 C. elegans sqt-1(sc1) II. Show Description
Homozygotes are short, dumpyish in L4 and adult. Roller in L3. Hets Roll. M-MATING+POOR <1%WT
BJS737 C. elegans mpk-1(sbj10) III. Show Description
Temperature sensitive allele of mpk-1, bypasses UV sensitivity of csb-1 mutant at 20-25C. Reference: Bianco JN & Schumacher B. Nucleic Acids Res. 2018 May 21. doi: 10.1093/nar/gky404.
BQ1 C. elegans akt-1(mg306) V. Show Description
BW1341 C. elegans nob-1(ct223) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain; typically segregates about 50% wild type progeny and 50% Nob larvae.
BW1561 C. elegans dpy-18(e364) nob-1(ct223) unc-25(e156) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain. The Dpy and Unc phenotypes are not visible in the Nob background. ct223 is recessive.
BW1634 C. elegans nob-1(ct223)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
WT hermaphrodites that segregate WT, Dpy Steriles and Nob larvae. The Nob phenotype results in 100% lethality. Maintain by picking WT.
BW1651 C. elegans nob-1(ct351) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain; segregates wild type progeny, Nob larvae, and occasional dead eggs. ct351 is recessive.
CA1117 C. elegans dsb-1(we11) IV/nT1[unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, dead eggs, and non-Uncs (dsb-1 homozygotes), which produce 99% inviable embryos due to meiotic nondisjunction. Pick Unc to maintain and check for correct segregation of progeny. we11 is a TCA to TAA nonsense mutation in the dsb-1 coding sequence that introduces a premature stop after leucine 96. Reference: Stamper EL, et al. PLoS Genet. 2013;9(8):e1003679.
CB2 C. elegans vab-1(e2) II. Show Description
Notched head. Penetrance <70%.
CB3031 C. elegans unc-17(e245) IV; snb-1(e1563) V. Show Description
Dominant suppressor of Unc. Movement almost WT.
CB51 C. elegans unc-13(e51) unc-122(n2916) I. Show Description
Unc. See WBPaper00003781 regarding the unc-122 mutation.
CB61 C. elegans dpy-5(e61) I. Show Description
Strong dumpy; early larvae non-Dpy.
CB7171 C. elegans tra-1(e1099) subs-4(e3026) III; eDp6 (III;f). Show Description
Pick wild-type to maintain. Wild-type hermaphrodites segregate wild-type and dead masculinized embryos. e3026 is nonsense mutation in essential gene Y47D3B.1. Reference: O'Rourke et al (in preparation).
CB81 C. elegans unc-18(e81) X. Show Description
Recessive, paralysed, kinky, thin at all stages, able to lay eggs.
CB91 C. elegans rol-1(e91) II. Show Description
Adults left-handed rollers.
CB933 C. elegans unc-17(e245) IV. Show Description
M-MATING-NO SUCCESS. UNC-Severe coiler at all stages-small and thin. SCORED EASILY. Suppressed by sup-1, sup-2, and snb-1. Resistant to lannate. See also CGC 1770.
CER244 C. elegans ikb-1(cer9) I. Show Description
cer9 is a CRISPR-generated 462 bp deletion at the beginning of the ikb-1 coding sequence, including the start codon (no transcript should be synthesized). Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
CER444 C. elegans sftb-1(cer114[mCherry::sftb-1]) III. Show Description
Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
CER529 C. elegans sftb-1(cer144) III. Show Description
Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
CF4639 C. elegans glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.