Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB2488 C. elegans F58G6.1(ok3443) IV. Show Description
F58G6.1 Homozygous. Outer Left Sequence: tttgataaacgctgttggca. Outer Right Sequence: ttcattgcacttttcccctc. Inner Left Sequence: cgaagaatgtgatacgactgtca. Inner Right Sequence: cgcattttcttcattcggtt. Inner Primer PCR Length: 1279. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB582 C. elegans C04G6.1(ok219) II. Show Description
C04G6.1 Homozygous. Outer Left Sequence: ACCCGTCATTTCTGAAAACG. Outer Right Sequence: GCCAACCTGGTGTCGTAGTT. Inner Left Sequence: GACGTGCTTTGTGCGAATTA. Inner Right Sequence: CACTTGAGCTCCCTCGAATC. Inner Primer PCR Length: 2564. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB592 C. elegans srp-6(ok319) V. Show Description
C03G6.19. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB635 C. elegans F07G6.2(ok362) X. Show Description
F07G6.2. Homozygous. Outer Left Sequence: tgcgctgtttagaattgtgc. Outer Right Sequence: ctcattgggcaaagtctggt. Inner Left Sequence: tgcgcagtgttccaataaag. Inner Right Sequence: atccgaaccattgactgagg. Inner primer WT PCR product: 2748. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB674 C. elegans stam-1(ok406) I. Show Description
C34G6.7. Homozygous. Outer Left Sequence: gctcaagagtgtggaggagg. Outer Right Sequence: gctcggaaaaatcactgctc. Inner Left Sequence: gattaatgggagaatgccga. Inner Right Sequence: ctgttgagaattgggaggga. Inner primer WT PCR product: 2799. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB799 C. elegans C25G6.5(ok594) X. Show Description
C25G6.5. Homozygous. Outer Left Sequence: CAGGGTCTTAACACGGCAAT. Outer Right Sequence: TGCCTTCAATTTCATCTCCC. Inner Left Sequence: CAAAAATTGGAAGGTGAGCC. Inner Right Sequence: AAATGGGATCGGTGAATGAA. Inner primer WT PCR product: 2691. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB840 C. elegans nhr-40(ok667) X. Show Description
T03G6.2 Homozygous. Outer Left Sequence: ATCAGTGTCCCCACCCATAA. Outer Right Sequence: GGCTTCCGTGTCTGAATGAT. Inner Left Sequence: TTCCATCTTTCTTCGTTCCG. Inner Right Sequence: TCGTCGACTTCTTTCCGTTT. Inner Primer PCR Length: 2895. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB918 C. elegans acr-16(ok789) V. Show Description
F25G6.3 Homozygous. Outer Left Sequence: CTTCATGCAACCCTTTCACA. Outer Right Sequence: AAAAGAAGACAGGTGCCACG. Inner Left Sequence: CAGGAGCGCAGATTGTATGA. Inner Right Sequence: AGTCCTCTGGGCTTTCCATT. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB927 C. elegans T11G6.8(ok801) IV. Show Description
T11G6.8. Homozygous. Outer Left Sequence: GCCATCATGTCGATGTCAAA. Outer Right Sequence: CAGCGAATTTTTGCGATTTT. Inner Left Sequence: CCGGAAAAATTGGGAAGATT. Inner Right Sequence: GAAAATTCCGCTGAGACGAG. Inner Primer PCR Length: 3163. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3058 C. elegans gldi-3(ve558[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
C01G6.5. Homozygous viable, Egl. Deletion of 3209 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: ttccacataagatcttaaaatacagaaata ; Right flanking sequence: ggtgggaaaaacagaagaaaagcatgtcgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3214 C. elegans C02G6.1(ve714[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 3831 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agccacttcctcgtgtattttcgtaaactt ; Right flanking sequence: atttaatttgcacttgattggaaacttttt. sgRNA #1: cagtgtaatgttaaaaggtt; sgRNA #2: ccaagctaggatatctgtgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW11848 C. elegans unc-119(tm4063) III; stIs11848. Show Description
stIs11848 [T11G6.8.1::H1-wCherry + unc-119(+)].
VC1066 C. elegans F29G6.2(gk456) X. Show Description
F29G6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1072 C. elegans F29G6.2(gk455) X. Show Description
F29G6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1129 C. elegans noah-1(ok1587)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
C34G6.6. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1587 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAGCAGATGAATCGAAACGG. External right primer: CTCGAGACAAGCCAATGTCA. Internal left primer: TCTTCACAGCCGATGACTTG. Internal right primer: CAATGAAGGTCTTTGCGGTT. Internal WT amplicon: 3308 bp. Deletion size: 2455 bp. Deletion left flank: TCACAGCCGATGACTTGATTTCAATAGCTC. Deletion right flank: TGAGAGTATACAATTTTGAAATATATTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1188 C. elegans T06G6.3(gk546) I. Show Description
T06G6.3. Superficially wild type. External left primer: GTAGGCGCTAAAACGACTGG. External right primer: AAATATTTTCCCGCCATTCC. Internal left primer: GAAATAAGGCGAGATGCAGG. Internal right primer: AGGCAAAGTCGAAGGTGAAA. Internal WT amplicon: 1775 bp. Deletion size: 808 bp. Deletion left flank: ACTAACCGGGGATTTTCGCTTCTCCGCGGC. Deletion right flank: AATTTTTGTTTATTTCAGAAGTAACATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1204 C. elegans nhr-34(gk556) IV. Show Description
F58G6.5. External left primer: CACCATCACATCCAGCTTTG. External right primer: TCGATTTTGTATTCCCTCGC. Internal left primer: TCGGCACCAAGCAATATGTA. Internal right primer: AAGCTTCTTGCGCTTTGAAC. Internal WT amplicon: 1669 bp. Deletion size: 1067 bp. Deletion left flank: ACATCAACTCTGCACAATTGATCGAATTCC. Deletion right flank: TACTATCTCAGATAATTTCTCTGTAACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1268 C. elegans K10G6.4(gk567) II. Show Description
K10G6.4. Superficially wild type. External left primer: CGTGGTGGAACTTTTCAGGT. External right primer: CAATTTTCACACATTCCCCC. Internal left primer: CGCAGAGCTTCTCAAACTCC. Internal right primer: AAATGTGGAACCCTGTTTGG. Internal WT amplicon: 1811 bp. Deletion size: 1561 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1269 C. elegans nhr-148(gk570) V. Show Description
C03G6.10. External left primer: GGAGCATTGATTTTTGGCAT. External right primer: AGACAAATTTGGAACGGCTG. Internal left primer: AGATGGCGAATGGATGTGTT. Internal right primer: TCACCTGGATTACAGCAGCA. Internal WT amplicon: 1912 bp. Deletion size: 1299 bp. Deletion left flank: TAACTCATTGAATATGTAATTATCAACTTT. Deletion right flank: AATATAGGCAAATAGTAGGGACCAAAGGAC. Insertion Sequence: ATAGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1270 C. elegans lin-31(gk569) II. Show Description
K10G6.1. Variable vulval phenotypes. Mostly wild type and able to lay eggs, but some animals have defective vulvae and become bags of worms. Some animals have multiple pseudovulvae. External left primer: TAGACACCCCACCATTCCAT. External right primer: TCGGCTGAACCAAATACACA. Internal left primer: CAGTTCTCGGGTGGTCTGAT. Internal right primer: AGCCTAATCCTAAGCCGGAG. Internal WT amplicon: 2297 bp. Deletion size: 1922 bp. Deletion left flank: TAGTGATGTGAATGTAAAACAAAGACTTAT. Deletion right flank: GCTTAAATTTAGGTTTAGGCTTAGGCTTAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1273 C. elegans nhr-28(gk568) X. Show Description
C11G6.4. External left primer: TAGCCTGCATTGGTGTTTCA. External right primer: GGCATACCCGTTTCTTCGTA. Internal left primer: TTTGACCGGTAGACTGCTGA. Internal right primer: TTGAACGGCTGAAAGTTGTG. Internal WT amplicon: 1920 bp. Deletion size: 1543 bp. Deletion left flank: AAACTTACCGTTGGCCACAGATTATTGCAT. Deletion right flank: AATTTCAAAAGTGAAAAGAGTGTGGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC134 C. elegans pgp-2(gk114) I. Show Description
C34G6.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1349 C. elegans nhr-47(gk954) V. Show Description
C24G6.4. Superficially wild type. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 742 bp. Deletion left flank: TTAATAATTCAATAATGTAAATTATTGAAT. Deletion right flank: GTAAGATCAATTTAACAAGCATCAAACATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1496 C. elegans nhr-130(gk684) V. Show Description
T01G6.8. External left primer: TTCGGATACTTTTCGGTTGC. External right primer: TTCCATTTTTACGGTCCTCG. Internal left primer: GATATGAGGTCCCGATCGAA. Internal right primer: TGAGGCAGATTGGTGTTCTG. Internal WT amplicon: 2444 bp. Deletion size: 834 bp. Deletion left flank: CCCGCAAGTTTTATCTCAAAATTTTGAATT. Deletion right flank: CGAAAAAATCGTAATAAAACGATTTTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1520 C. elegans nhr-130(gk710) V. Show Description
T01G6.8. External left primer: TTCGGATACTTTTCGGTTGC. External right primer: TTCCATTTTTACGGTCCTCG. Internal left primer: GATATGAGGTCCCGATCGAA. Internal right primer: TGAGGCAGATTGGTGTTCTG. Internal WT amplicon: 2444 bp. Deletion size: 1218 bp. Deletion left flank: TTTGAAGCTTCCGCAAAAATTTACATTCCC. Deletion right flank: AAAAAAAATACCGGAAAATAGGCTCCGCCC. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1585 C. elegans nhr-147(gk741) V. Show Description
C03G6.8. External left primer: CGCCCAGATGAACTTTGTTT. External right primer: TGATTTTCCAAAAGCCCAAG. Internal left primer: CCGTACGGATGTATCTGCCT. Internal right primer: CCAAATTGTTGGCGTTCTTT. Internal WT amplicon: 2189 bp. Deletion size: 762 bp. Deletion left flank: AGTGCTAAAGGCTATCATTATGACGTCATT. Deletion right flank: TCTCCAGAAAATTTGATAATTACTTGAACC. Insertion Sequence: CTTGTTTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2284 C. elegans T06G6(gk1097) I. Show Description
T06G6. Identified by PCR, validated by CGH. External left primer: AATCTTGGGGAGTCCCAACT. External right primer: ATGGTGGTGGAAGGTTTCAG. Internal left primer: ATTGCGATGACTTTGCACTG. Internal right primer: GTTGATTGCTCAGCTGGGTT. Internal WT amplicon: 1577 bp. Deletion size: 626 bp. Deletion left flank: AATACATATGTTCCTAATCCTCCATTACCT. Deletion right flank: ATGACCTAATTTTTTAGTAGGTCAAGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3008 C. elegans T06G6.5(gk1278) I. Show Description
T06G6.5. External left primer: GCAACCTCTACCGTAACCCA. External right primer: GGGCATATACTCTGGCGAAA. Internal left primer: TTCGCACATATCTGTTGGTTTC. Internal right primer: ATGGGTACATTTTTGGAACTGG. Internal WT amplicon: 1372 bp. Deletion size: 1128 bp. Deletion left flank: ATATCTGTTGGTTTCCATATTTCGAAAATG. Deletion right flank: CCACTTACCATGTAAACACATCTACTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3028 C. elegans T03G6.3(ok3710) X. Show Description
T03G6.3. External left primer: GGTGAATTCTCAGTGCACCA. External right primer: CGGAAAAGCTGGAGTAGACG. Internal left primer: ACTTAGAGTTGCCGACCAGG. Internal right primer: TTATTGGTTTGCACATTGCC. Internal WT amplicon: 1269 bp. Deletion size: 572 bp. Deletion left flank: TTGTTCCTGGCTTTGTAATCAGTACAACAC. Deletion right flank: AAGCATCGGTGGTTCAGTGGTAGAATGCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC303 C. elegans +/nT1 IV; stdh-4(ok543)/nT1 V. Show Description
F25G6.5. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok543 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC345 C. elegans sgk-1(ok538) X. Show Description
W10G6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4580 C. elegans F25G6.9(gk5651[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 4606 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTAACCGAACAAAATAGGAGACACCAGTC. Right flanking sequence: CGCGGGTTCCACGGGATTCATGTCGAAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4862 C. elegans F25G6.8(gk5930[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 623 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AAATGAGGATGAAATACAATGGAAAGCCCA. Right flanking sequence: TGGGAATATGTTGTTCAACTGCCGACATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC536 C. elegans mtrr-1(ok718)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C01G6.6. Homozygous lethal deletion balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, Dpy bright GFP mIn1 homozygotes, and non-GFP ok718 homozygotes (early larval arrest). Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC710 C. elegans cyp-35A2(gk317) V. Show Description
C03G6.15. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC743 C. elegans cyp-35A2(gk326) V. Show Description
C03G6.15. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC798 C. elegans tag-293(ok1337) V. Show Description
C03G6.13. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC875 C. elegans cyp-35A1(ok1414) V. Show Description
C03G6.14. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH7158 C. elegans R05G6.5(hd7158[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGTTCAAAGGCAAGCACATTGGCGCGGC; Right flanking sequence: TGGAATATATTATTCAAAAACGACAATTGC. sgRNA #1: GACCGCCCGTCTCGAGACAT; sgRNA #2: TTCAGAATGAGTTCAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
BAY7 C. elegans yanSi1 II; unc-119(ed3) III. Show Description
yanSi1 [eft-3p::dCAS9::VP64::tbb-2 3'UTR + Cbr-unc-119(+)] inserted into ttTi5605 (II:8.42 MB) in parental strain EG6699. Integration plasmid was generated via 3-way gateway reaction with pCFJ150 and plasmids containing eft-3 promoter (ID:1031@E02 promoterome), tbb-2 3'UTR (pCM1.36), and a full length dcas9::VP64 transgene cloned into pDONR201. Reference: Zullo JM, et al. Nature. 2019 Oct;574(7778):359-364. doi: 10.1038/s41586-019-1647-8. PMID: 31619788.
BC10588 C. elegans dpy-5(e907) I; sIs10126. Show Description
sIs10126 [rCes Y47G6A.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11990 C. elegans dpy-5(e907) I; sEx11990. Show Description
sEx11990 [rCesY106G6E.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12786 C. elegans dpy-5(e907) I; sIs11990. Show Description
sIs11990 [rCesY106G6E.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14514 C. elegans dpy-5(e907) I; sEx14514. Show Description
sEx14514 [rCes Y47G6A.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC16340 C. elegans dpy-5(e907) I; sEx16340. Show Description
sEx16340 [rCes Y106G6H.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BN711 C. elegans unc-119(ed3) III; bqSi711 IV. Show Description
bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Constitutive co-expression of codon-optimised FLP and fluorescent mNeonGreen in the germ line. Reference: Macias-Leon J & Askjaer P. (2018): Efficient FLP-mediated germ-line recombination in C. elegans. Micropublication:biology. Dataset. https://doi.org/10.17912/W2G66S
BR2742 C. elegans pept-1(lg601) X. Show Description
Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45.
BZ1202 C. elegans seb-3(eg696) X. Show Description
This strain is tolerant to acute treatment of ethanol. The severity and incidence of stress-induced tremors are greater than in wild-type. Reference: Jee C, et al. Genes Brain Behav. 2013 Mar;12(2):250-62.
CG625 C. elegans unc-103(n1213) pha-1(e2123) III; him-5(e1490) V; rgEx235. Show Description
rgEx235 [plc-3p::YFP + pha-1(+)]. Expresses YFP from a 4.4bk upstream plc-3 promoter. Maintain at 20C.
CG640 C. elegans daf-2(e1368) unc-103(n1213) III; him-5(e1490) V; rgEx247. Show Description
rgEx247 [hsp-16p::daf-2(+) + lev-11p::GFP]. rgEx247 restores food-deprivation suppression of unc-103(n1213)-induced spicule protraction.