Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
JDW840 C. elegans skpo-1(wrd348[skpo-1::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous skpo-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW850 C. elegans col-75(wrd349[col-75::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-75 locus by CRISPR. Allele obtained using plasmid-based unc-119 selection in a temperature-sensitive unc-119(kst33) III background The unc-119(+) cassette was removed through Cre-mediated excision and the unc-119(kst33) allele was removed by outcrossing. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW877 C. elegans wrt-2(wrd365[linker::mNG::3xFLAG::linker (internal)]) X Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 1 in the endogenous wrt-2 locus by CRISPR; produces a translation fusion after amino acid 18, immediately following the signal peptide.. Allele obtained using plasmid-based unc-119 selection in a temperature-sensitive unc-119(kst33) III background The unc-119(+) cassette was removed through Cre-mediated excision and the unc-119(kst33) allele was removed by outcrossing. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW910 C. elegans crim-1(wrd384[crim-1::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous crim-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. Superficially wild type.
KRA345 C. elegans cfi-1(kas16[mNG::AID*::cfi-1]) I. Show Description
mNeonGreen and AID* tags inserted into endogenous cfi-1 locus. Transgene can be degraded in a background expressing TIR1 co-factor supplemented with auxin. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.
KRA467 C. elegans lin-39(kas9[lin-39::mNG::AID*]) III. Show Description
mNeonGreen::3xFLAG::AID* was inserted at the C-terminus of the endogenous lin-39 locus by CRISPR. Endogenous lin-39 expression marked by mNG. LIN-39 protein can be degraded by Auxin application with expression of TIR-1 protein. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
LP212 C. elegans pkc-3(cp41[mNeonGreen:3xFlag::pkc-3 + LoxP]) II. Show Description
mNG::aPKC endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP216 C. elegans par-6(cp45[par-6::mNeonGreen::3xFlag + LoxP unc-119(+) LoxP]) I; unc-119(ed3) III. Show Description
PAR-6::mNG endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP242 C. elegans par-3(cp54[mNeonGreen::3xFlag::par-3]) III. Show Description
mNG::PAR-3 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP362 C. elegans gex-3(cp114[mNG-C1^3xFlag::gex-3]) IV. Show Description
mNG:GEX-3 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP373 C. elegans mex-5(cp125[mNG-C1^3xFlag::mex-5]) IV. Show Description
mNG::MEX-5 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP393 C. elegans oma-2(cp145[mNG-C1^3xFlag::oma-2]) V. Show Description
mNG::OMA-2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP399 C. elegans rap-1(cp151[mNG-C1^3xFlag::rap-1]) IV. Show Description
mNG::RAP-1 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP435 C elegans apr-1(cp166[mNG-C1^3xFlag::apr-1]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP439 C elegans nud-2(cp170[nud-2::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP443 C elegans klp-17(cp174[klp-17::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP447 C elegans klp-7(cp178[klp-7::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP451 C elegans bicd-1(cp180[mNG-C1^3xFlag::bicd-1]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP511 C. elegans lin-3(cp226[lin-3::mNG::3xFLAG]) IV. Show Description
mNG and 3xFlag tags inserted into the C-terminus of the endogenous lin-3 locus.
LP515 C. elegans cpIs89 I; cpIs85 II; egl-20(cp221[egl-20::mNG::3xFlag]) IV. Show Description
cpIs89 [wrt-2p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs85 [egl-20p::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. 2x mTurquoise2::PH membrane marker expressed in seam cells, Q neuroblasts, and many hypodermal cells. Expression of 2x mKate2::PH membrane marker driven by egl-20 upstream intergenic sequence. cpIs89 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs85 is a single copy transgene inserted at Chr II:8420157-8420243 near ttTi5605 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
LP521 C elegans klp-12(cp234[klp-12::mNG-C1^3xFlag]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP527 C elegans mes-1(cp240[mes-1::mNG-C1^3xFlag] X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP530 C elegans cam-1(cp243[cam-1::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP538 C. elegans gsk-3(cp251[gsk-3::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP559 C. elegans mom-2(cp267[mom-2::mNG-C1^3xFlag]) V. Show Description
FP fusion. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP560 C elegans dhc-1(cp268[dhc::mNG-C1::3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP563 C elegans dnc-1(cp271[dnc::mNG-C1::3xFlag]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP585 C elegans lin-5(cp288[lin-5::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP591 C elegans lis-1(cp294[lis-1::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP598 C elegans dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP600 C elegans klp-4(cp303[klp-4::mNG-C1::3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP604 C elegans klp-8(cp307[klp-8::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP608 C elegans klp-20(cp311[klp-20::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP637 C. elegans par-2(cp329[mNG-C1^par-2]) III. Show Description
mNG::PAR-2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP697 C. elegans mom-5(cp367[mom-5::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP705 C elegans dsh-1(cp375[dsh-1DIX::mNG-C1^3xFlag::PDZ,DEP]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP713 C elegans pry-1(cp383[pry-1::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP728 C elegans mig-5(cp385[mNG-GLO::AID*::mig-5]) II. Show Description
FP knock-in. mNG-GLO is a germline-optimized variant coded to be less prone to silencing in the germline. [NOTE: (4/1/2021) A lab has reported finding a second GFP insertion in LP728; it has not yet been confirmed whether or not it is present in the current CGC stock.] Reference: Heppert JK, et al. 2017 Genetics. In press.
LP858 C. elegans lea-1(cp431[mNG::3x FLAG::AID*::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
LP860 C. elegans daf-2(e1370) III; lea-1(cp431[mNG::3x FLAG::AID*::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
LP893 C. elegans unc-94a(cp437[mNG-C1::unc-94a]) I. Show Description
mNG reporter inserted into endogenous unc-94 locus, specifically tagging the UNC-94A isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102.
LP894 C. elegans unc-94b(cp438[mNG-C1::unc-94b]) I. Show Description
mNG reporter inserted into endogenous unc-94b locus, specifically tagging the UNC-94B isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.
LP896 C. elegans unc-94(cp439[unc-94::mNG-C1]) I; cap-1(cp436[mScarlet-I-C1::cap-1]) IV. Show Description
mNG reporter inserted into endogenous unc-94b locus. m-Scarlet-I reporter inserted into endogenous cap-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.
LP897 C. elegans fli-1(cp440[fli-1::mNG-C1]) III. Show Description
mNG reporter inserted into endogenous fli-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.
LP898 C. elegans eps-8(cp441[eps-8::mNG-C1]) IV. Show Description
mNG reporter inserted into endogenous eps-8 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566..
MDX44 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
NFB1722 C. elegans lag-1(vlc30[lag-1::T2A::mNG]) IV. Show Description
mNeonGreen tag inserted into endogenous lag-1 locus. Upstream flanking sequence: CCTACAAATCATTGGAACGACATGGACCGTGCAGAATTGTGTCCAATTAC. Downstream flanking sequence: TAGATTGGTCTCTCGCGGGATTACTGTATCTTTATATTGTCTCCTAATTT. Guide sequence: ATTACTAGATTCCACTCTCG. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NK2115 C. elegans cpIs121 I; rrf-3(pk1426) II; rde-1(ne219) V. Show Description
cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284.
NK2318 C. elegans dgn-1(qy18[dgn-1::mNG]) X. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2322 C. elegans cle-1(qy22[cle-1::mNG+loxP]) I. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.