| LP242 |
C. elegans |
par-3(cp54[mNeonGreen::3xFlag::par-3]) III. Show Description
mNG::PAR-3 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
|
|
| LP362 |
C. elegans |
gex-3(cp114[mNG-C1^3xFlag::gex-3]) IV. Show Description
mNG:GEX-3 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
|
|
| LP373 |
C. elegans |
mex-5(cp125[mNG-C1^3xFlag::mex-5]) IV. Show Description
mNG::MEX-5 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
|
|
| LP393 |
C. elegans |
oma-2(cp145[mNG-C1^3xFlag::oma-2]) V. Show Description
mNG::OMA-2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
|
|
| LP399 |
C. elegans |
rap-1(cp151[mNG-C1^3xFlag::rap-1]) IV. Show Description
mNG::RAP-1 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
|
|
| LP435 |
C elegans |
apr-1(cp166[mNG-C1^3xFlag::apr-1]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP439 |
C elegans |
nud-2(cp170[nud-2::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP443 |
C elegans |
klp-17(cp174[klp-17::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP447 |
C elegans |
klp-7(cp178[klp-7::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP451 |
C elegans |
bicd-1(cp180[mNG-C1^3xFlag::bicd-1]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP511 |
C. elegans |
lin-3(cp226[lin-3::mNG::3xFLAG]) IV. Show Description
mNG and 3xFlag tags inserted into the C-terminus of the endogenous lin-3 locus.
|
|
| LP515 |
C. elegans |
cpIs89 I; cpIs85 II; egl-20(cp221[egl-20::mNG::3xFlag]) IV. Show Description
cpIs89 [wrt-2p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs85 [egl-20p::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. 2x mTurquoise2::PH membrane marker expressed in seam cells, Q neuroblasts, and many hypodermal cells. Expression of 2x mKate2::PH membrane marker driven by egl-20 upstream intergenic sequence. cpIs89 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs85 is a single copy transgene inserted at Chr II:8420157-8420243 near ttTi5605 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| LP521 |
C elegans |
klp-12(cp234[klp-12::mNG-C1^3xFlag]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP527 |
C elegans |
mes-1(cp240[mes-1::mNG-C1^3xFlag] X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP530 |
C elegans |
cam-1(cp243[cam-1::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP538 |
C. elegans |
gsk-3(cp251[gsk-3::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP559 |
C. elegans |
mom-2(cp267[mom-2::mNG-C1^3xFlag]) V. Show Description
FP fusion. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP560 |
C elegans |
dhc-1(cp268[dhc::mNG-C1::3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP563 |
C elegans |
dnc-1(cp271[dnc::mNG-C1::3xFlag]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP585 |
C elegans |
lin-5(cp288[lin-5::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP591 |
C elegans |
lis-1(cp294[lis-1::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP598 |
C elegans |
dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP600 |
C elegans |
klp-4(cp303[klp-4::mNG-C1::3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP604 |
C elegans |
klp-8(cp307[klp-8::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP608 |
C elegans |
klp-20(cp311[klp-20::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP637 |
C. elegans |
par-2(cp329[mNG-C1^par-2]) III. Show Description
mNG::PAR-2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
|
|
| LP697 |
C. elegans |
mom-5(cp367[mom-5::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP705 |
C elegans |
dsh-1(cp375[dsh-1DIX::mNG-C1^3xFlag::PDZ,DEP]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP713 |
C elegans |
pry-1(cp383[pry-1::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP728 |
C elegans |
mig-5(cp385[mNG-GLO::AID*::mig-5]) II. Show Description
FP knock-in. mNG-GLO is a germline-optimized variant coded to be less prone to silencing in the germline. [NOTE: (4/1/2021) A lab has reported finding a second GFP insertion in LP728; it has not yet been confirmed whether or not it is present in the current CGC stock.] Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
| LP858 |
C. elegans |
lea-1(cp431[mNG::3x FLAG::AID*::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
| LP860 |
C. elegans |
daf-2(e1370) III; lea-1(cp431[mNG::3x FLAG::AID*::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
| LP893 |
C. elegans |
unc-94a(cp437[mNG-C1::unc-94a]) I. Show Description
mNG reporter inserted into endogenous unc-94 locus, specifically tagging the UNC-94A isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102.
doi: 10.1083/jcb.202302102.
|
|
| LP894 |
C. elegans |
unc-94b(cp438[mNG-C1::unc-94b]) I. Show Description
mNG reporter inserted into endogenous unc-94b locus, specifically tagging the UNC-94B isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.
|
|
| LP896 |
C. elegans |
unc-94(cp439[unc-94::mNG-C1]) I; cap-1(cp436[mScarlet-I-C1::cap-1]) IV. Show Description
mNG reporter inserted into endogenous unc-94b locus. m-Scarlet-I reporter inserted into endogenous cap-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.
|
|
| LP897 |
C. elegans |
fli-1(cp440[fli-1::mNG-C1]) III. Show Description
mNG reporter inserted into endogenous fli-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.
|
|
| LP898 |
C. elegans |
eps-8(cp441[eps-8::mNG-C1]) IV. Show Description
mNG reporter inserted into endogenous eps-8 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566..
|
|
| MDX44 |
C. elegans |
cylc-2(mon2[cylc-2::mNG::3xFLAG) I. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
|
|
| NFB1722 |
C. elegans |
lag-1(vlc30[lag-1::T2A::mNG]) IV. Show Description
mNeonGreen tag inserted into endogenous lag-1 locus. Upstream flanking sequence: CCTACAAATCATTGGAACGACATGGACCGTGCAGAATTGTGTCCAATTAC. Downstream flanking sequence: TAGATTGGTCTCTCGCGGGATTACTGTATCTTTATATTGTCTCCTAATTT. Guide sequence: ATTACTAGATTCCACTCTCG. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NK2115 |
C. elegans |
cpIs121 I; rrf-3(pk1426) II; rde-1(ne219) V. Show Description
cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284.
|
|
| NK2318 |
C. elegans |
dgn-1(qy18[dgn-1::mNG]) X. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2322 |
C. elegans |
cle-1(qy22[cle-1::mNG+loxP]) I. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2324 |
C. elegans |
ina-1(qy23[ina-1::mNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2326 |
C. elegans |
emb-9(qy24[emb-9::mNG+loxP]) III. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2335 |
C. elegans |
lam-2(qy20[lam-2::mNG+LoxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2353 |
C. elegans |
agr-1 (qy27[agr-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2404 |
C. elegans |
epi-1(qy31[epi-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2413 |
C. elegans |
sdn-1(qy29[sdn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2422 |
C. elegans |
him-4(qy33[him-4::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2425 |
C. elegans |
lam-3(qy28[lam-3::mNG+loxP]) I. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
