More Fields
Strain Species Genotype
CB1417 C. elegans lin-3(e1417) IV. Show Description
Vulvaless. Recessive. M-MATING+++ 10-30%WT.
MT378 C. elegans lin-3(n378) IV. Show Description
Vulvaless. Isolated in lin-8(n111); this strain may still contain n111.
MT1348 C. elegans dpy-20(e1362) lin-3(e1417) IV. Show Description
Dpy. Vul.
PS1378 C. elegans itr-1(sy290) lin-3(n1058) IV. Show Description
This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT723 C. elegans lin-28(n719) I; lin-3(e1417) IV. Show Description
Egl. Vulvaless due to lin-3. Precocious VPC divisions and adult alae due to lin-28.
MT2136 C. elegans lin-3(n1058)/unc-8(e49) dpy-20(e1362) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Steriles (n1058 homozygotes). The n1058 homozygous larvae are occasionally paralyzed. Maintain by picking WT.
PS1595 C. elegans lfe-2(sy326) I; lin-3(n1058) dpy-20(e1282) IV. Show Description
sy326 suppresss the sterility of n1058. Dpy. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
UP2813 C. elegans csSi3 [lin-3::lin-3S + unc-119(+)] II; lin-3(n1059) IV/nT1[qIs51] (IV;V) Show Description
lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3S (short) splice isoform, expressed under control of the lin-3 promoter. The transgene rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.
UP2814 C. elegans csSi1 [lin-3::lin-3L + unc-119(+)] II; lin-3(n1059) IV/nT1[qIs51] (IV;V) Show Description
lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3L (long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.
UP2815 C. elegans csSi2 [lin-3::lin-3XL + unc-119(+)] II; lin-3(n1059) IV/nT1[qIs51] (IV;V) Show Description
lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3XL (extra long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethality (but not Vulvaless or sterile phenotypes) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.
PJ1166 C. elegans daf-2(m41) III; ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Arrest as dauers at 25C. Maintain at 15C.
MT4684 C. elegans lin-3(n1059) dpy-20(e1362)/unc-24(e138) mec-3(e1338) dpy-20(e1282) IV. Show Description
Heterozygotes are Dpy and segregate Dpy, Dpy Lethals (early larval) and DpyUncMec.
PS1123 C. elegans unc-31(e169) IV; syIs1 X. Show Description
syIs1 [lin-3(genomic) + rol-6(su1006)]. Animals are Muv due to overexpression of lin-3. Unknown if unc-31(e169) is present in this strain. See also WBPaper00004853. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1427 C. elegans syIs6. Show Description
syIs6 [hsp-16.41p::lin-3]. Chromosomal insertion of the extrachromosomal array syEx23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2037 C. elegans syIs12 II. Show Description
syIs12 [hsp::lin-3 + dpy-20(+)]. "low dose" overexpressor of the EGF repeat of lin-3 under control of the heat shock promoter. Wild type vulval differentiation when grown at 20C. Muv phenotype resulting from heat shock at L2 lethargis. Reference: Katz WS, et al. Cell. 1995 Jul 28;82(2):297-307. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2286 C. elegans unc-38(x20) lfe-2(sy326) I. Show Description
Fertile Unc-38. sy326 has no phenotype on its own. Suppresses sterility of let-23(sy10) and lin-3(n1058). Sterile in double mutant combination with lfe-1 alleles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2366 C. elegans itr-1(sy328) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2368 C. elegans itr-1(sy327) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2512 C. elegans itr-1(sy331) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2516 C. elegans itr-1(sy291) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2582 C. elegans itr-1(sy290) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3653 C. elegans ipp-5(sy605) X. Show Description
Subtle ovulation defect which is viewable by Nomarski - 2 oocytes ovulate (pass into uterus) at the same time. Double mutants with lfe-2(sy326) and lfe-1(sy290) show sterility. Double mutant with lin-3(n1058) is fertile. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4308 C. elegans unc-119(ed4) III; syIs107. Show Description
syIs107 [lin-3(delta pes-10)::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4309 C. elegans unc-119(ed4) III; syIs108. Show Description
syIs108 [lin-3(delta pes-10)::GFP + unc-119(+)]. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS5970 C. elegans him-5(e1490) syIs197 V. Show Description
syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.
AWR41 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I. Show Description
N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR54 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of eft-3p::TIR1::mRuby allows auxin-inducible degradation of LIN-35 in somatic tissues. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR56 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi64 II. Show Description
ieSi64 [gld-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of gld-1p::TIR1::mRuby allows for auxin inducible degradation of LIN-35 in the germline. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR58 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; keaSi10 II. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of LIN-35 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
CB3574 C. elegans lin-30(e1908) III. Show Description
Variable failures in cytokinesis. Mostly viable and fertile.
CB4377 C. elegans lin-22(n372) pal-2(e2260) IV; him-5(e1490) V; lin-32(e1926) X. Show Description
Hermaphrodites segregating males with abnormal ray lineages. Reference: Hodgkin et al. (1989) Genome, 31, 625-637. doi:10.1139/g89-116.
CB4793 C. elegans mup-1(e2430) lin-31(n301) unc-85(e1414) II. Show Description
mup-1(e2430) is a temperature sensitive two-fold arrest lethal. Maintain at 15C. Easily scored, at restrictive temperature they look like tiny little croissants. Muv and Unc.
CF267 C. elegans muIs6 IV. Show Description
muIs6 [lin-39::lacZ + rol-6(su1006)] IV. lin-39 promoter driving lacZ. muIs6 was integrated by gamma irradiation.
CF439 C. elegans lin-39(n1760) III; dpy-20(e1282) IV; him-5(e1490) V; muIs23. Show Description
muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown.
CF491 C. elegans pry-1(mu38) I; him-5(e1490) V. Show Description
Very sick, Muv, Scrawny. Extra rays in males in body. Ectopic expression of lin-39, mab-5, egl-5. Cold sensitive - grows better at 25C.
CZ7112 C. elegans lin-31(n301) vab-1(e2027) II. Show Description
Muv.
DZ390 C. elegans ezIs10 II; unc-119(ed3) III; him-8(e1489) IV. Show Description
ezIs10 [(pWY3) lin-32::GFP + unc-119(+)].
EG8912 C. elegans oxTi969 II; unc-119(ed3) III. Show Description
oxTi969 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:18.17). Insertion into lin-38. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EM172 C. elegans unc-4(e120) II; him-5(e1490) V; lin-32(bx46) X. Show Description
Missing Rays. Unc.
EM496 C. elegans hlh-2(bx108) I; him-5(e1490) V; lin-32(e1926) X. Show Description
Males are rayless. hlh-2(bx108) strongly and semi-dominantly enhances the ray-loss phenotype of lin-32(e1926).
EW45 C. elegans smg-1(e1228) I; unc-30(e191) IV; deIs1. Show Description
deIs1[unc-30(+) + lin-39TL::GFP (yeast DNA)]. A translational fusion of GFP to the C terminus of LIN-39. Present on a YAC. Yeast chromosomal DNA was injected and integrated. Expression is very faint.
EW61 C. elegans dpy-20(e1282) IV; him-5(e1490) V; deIs4. Show Description
deIs4 [ajm-1::GFP + GFP::lin-39(YAC) + dpy-20(+)]. A transcriptional fusion of GFP to the ATG of lin-39, with a stop codon between GFP and LIN-39 sequences. Present on a YAC. Yeast chromosomal DNA was injected and integrated. Expression is very faint and may get fainter over time. Freeze upon receipt.
EW62 C. elegans smg-1(e1228) I; dpy-20(e1282) IV; him-5(e1490) V; deIs4. Show Description
deIs4 [ajm-1::GFP + GFP::lin-39(YAC) + dpy-20(+)]. A transcriptional fusion of GFP to the ATG of lin-39, with a stop codon between GFP and LIN-39 sequences. Present on a YAC. Yeast chromosomal DNA was injected and integrated. Expression is very faint and may get fainter over time. Therefore, freeze upon receipt.
GR1379 C. elegans lin-35(n745) I; eri-1(mg366) IV. Show Description
Temperature sensitive sterile at 25C. Maintain at 15C.
GS8190 C. elegans arTi85. Show Description
arTi85 [lin-31p::ERK::KTR::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi85 transgene is a single-copy transposon insertion expressing a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
GS8255 C. elegans arTi101. Show Description
arTi101 [lin-31p::ERK::KTR(S43A, T55A, S62A)::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi101 transgene is a single-copy transposon insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Use arTi101 as a negative control for transgene arTi85. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
IG256 C. elegans xnp-1(tm678) I. Show Description
Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59.
JU2039 C. elegans mfIs70 IV; rde-1(ne219) V. Show Description
mfIs70 [lin-31p::rde-1 + myo2p::GFP]. mfIs70 is a spontaneous integration in LG IV. Superficially wild-type. This strain can be used for Pn.p-specific RNAi. Reference: Barkoulas et al. (2013) Developmental Cell Jan 14;24(1):64-75
JU2058 C. elegans rrf-3(pk1426) II; mfIs70 IV; rde-1(ne219) V. Show Description
mfIs70 [lin-31p::rde-1 + myo2p::GFP]. mfIs70 is a spontaneous integration in LG IV. Superficially wild-type. This strain can be used for Pn.p-specific RNAi. Reference: Barkoulas et al. (2013) Developmental Cell Jan 14;24(1):64-75
KRA102 C. elegans lin-39(kas1) III; ynIs40 V; unc-3(n3435) X. Show Description
ynIs40 [flp-11p::GFP] V. kas1 is a point mutation in the second intron splice acceptor site, disrupting splicing. Worms are vulvaless and have severe locomotion defects. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.