FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. apr-1(bp298) is a G338E missense mutation disrupts the normal asymmetric division pattern of seam cells, causing symmetric divisions. Reference: Huang XX, et al. Dev Biol. 2009 Sep 15;333(2):337-47.

zhEx11[apr-1(+) + sur-5::GFP]. Unc. Segregates dead eggs that have lost the rescuing array.

K04G2.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2970 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGATTTGTGATGGCACAGT. External right primer: GCAGCACCAGAAGTTGATGA. Internal left primer: ATGGTAACGATTTTCCAGCG. Internal right primer: TGGTTCTTCAGCAGTTAATCCA. Internal WT amplicon: 1205 bp. Deletion size: 665 bp. Deletion left flank: TCATCAATTGACGTCTCAACAGCAGAACAC. Deletion right flank: GCTCAGACTGGTCTCCACAACAACAATTAC. Insertion Sequence: AGGACACCCAGCGATCATAACGGCATTGATGTGGCAAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

osEx211[apr-1::GFP + unc-76(+)]. This strain expresses functional APR-1::GFP driven by the apr-1 promoter. In the seam cells, just prior to the onset of mitosis, APR-1::GFP localizes to the anterior cortex.

osIs15 [pie-1p::GFP::apr-1 + unc-119(+)]. Non-Unc. Reference: Cell. 2011 Sep 16;146(6):942-54.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7144 and CGC92. hd7144 is a 5280 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTGAAGAATAGCAGCAAAAACGGTCACCT; Right flanking sequence: ATTACTTTTTTTTAAAAAGTACAGTATCAA. sgRNA #1: ACAGGTGTTTACAATGCGAG; sgRNA #2: TATTTTCTTACAGTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.