| NK2324 |
C. elegans |
ina-1(qy23[ina-1::mNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2326 |
C. elegans |
emb-9(qy24[emb-9::mNG+loxP]) III. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2335 |
C. elegans |
lam-2(qy20[lam-2::mNG+LoxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2353 |
C. elegans |
agr-1 (qy27[agr-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2404 |
C. elegans |
epi-1(qy31[epi-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2413 |
C. elegans |
sdn-1(qy29[sdn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2422 |
C. elegans |
him-4(qy33[him-4::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2425 |
C. elegans |
lam-3(qy28[lam-3::mNG+loxP]) I. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2436 |
C. elegans |
pat-3(qy36[pat-3::mNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2442 |
C. elegans |
mig-6(qy37[mNG+loxP::mig-6]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. mNeonGreen is inserted at the N-terminus right before a putative proprotein convertase cleavage site and Western analysis indicates most of the mNeonGreen is cut from the MIG-1 protein and is diffuse in the extracellular fluid. See Figure S1 in Keeley et al., Dev Cell. 2020 Jul 6;54(1):60-74.e7. doi: 10.1016/j.devcel.2020.05.022. PMID: 32585132
|
|
| NK2443 |
C. elegans |
nid-1(qy38[nid-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2444 |
C. elegans |
pxn-2(qy39[pxn-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2445 |
C. elegans |
pxn-1(qy40[pxn-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2456 |
C. elegans |
ddr-1(qy43[ddr-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2457 |
C. elegans |
ddr-2(qy44[ddr-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2477 |
C. elegans |
ptp-3(qy47[ptp-3::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2478 |
C. elegans |
deb-1(qy48[deb-1::mNG + LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen tag into endogenous deb-1 locus. Low penetrance Rup and Pvl. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383.
|
|
| NK2479 |
C. elegans |
pat-2(qy49[pat-2::2xmNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2500 |
C. elegans |
unc-52(qy53[unc-52::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2502 |
C. elegans |
ten-1(qy56[ten-1::mNG+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2503 |
C. elegans |
rap-3(qy57[rap-3::mNG]) IV. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2540 |
C. elegans |
fdgt-1(qy65[fgt-1::mNG +loxP]) II. Show Description
Superficially wild-type. mNG tag inserted into the endogenous fgt-1 locus. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2555 |
C. elegans |
unc-52(qy75[mNG+loxP::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2557 |
C. elegans |
mig-6(qy73[mig-6::mNG+loxP]) V. Show Description
Superficially wild-type. Specifically tags the long isoform of mig-6. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2565 |
C. elegans |
pxn-2(qy76[mNG+loxP::pxn-2]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2579 |
C. elegans |
fbl-1(qy62[mNG+loxP::fbl-1]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2580 |
C. elegans |
spon-1(qy30[spon-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2581 |
C. elegans |
gpn-1(qy35[gpn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2582 |
C. elegans |
lon-2(qy55[lon-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2583 |
C. elegans |
unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2590 |
C. elegans |
gon-1(qy45[gon-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2621 |
C. elegans |
eif-1.A(qy90[eif-1.A::mNG]) IV. Show Description
mNG tag inserted into the C-terminus of the endogenous eif-1.A locus.
|
|
| NK2623 |
C. elegans |
ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
mNeonGreen tag inserted into the endogenous ucr-2.1 locus (C-terminus tag). Insertion verified by PCR. Left flanking sequence: 5' TCAGAAGGAACGACTCGTTG 3' ; Right flanking sequence: 5' CGAAAGTAGAATGCTAGTCAAG 3'. sgRNA: 5' TTTATAGCTCGTCGAGATAT 3'. Superficially wild-type.
|
|
| NK2631 |
C.elegans |
qySi99 I; unc-6(ev400) X. Show Description
qySi99 [lin-29p::fdgt-1::mNG + loxP] I. Unc. Single-copy insertion. unc-6 mutant expressing anchor cell specific fdgt-1 glucose transporter. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell 2022 March 21. https://doi.org/10.1016/j.devcel.2022.02.019
|
|
| NK2632 |
C. elegans |
qySi99 I. Show Description
qySi99 [lin-29p::fdgt-1::mNG] I. Single-copy insertion of mNG-tagged fdgt-1. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2633 |
C. elegans |
elo-1(qy97[elo-1::mNG]) IV. Show Description
mNG tag inserted into the C-terminus of the endogenous elo-1 locus.
|
|
| NK2636 |
C. elegans |
fasn-1(qy98[fasn-1::mNG]) I. Show Description
fasn-1 locus endogenously tagged with mNG at the C-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2643 |
C. elegans |
lin-35(n745) I; unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous unc-52 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2644 |
C. elegans |
lin-35(n745) I; fbl-1(qy62[mNG+loxP::fbl-1]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous fbl-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2645 |
C. elegans |
lin-35(n745) I; him-4(qy33[him-4::mNG+loxP]) X. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous him-4 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2657 |
C. elegans |
nuo-1(qy143[nuo-1::mNG]) II; unc-119(ed4) III; qyIs50 V. Show Description
qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.
|
|
| NK2667 |
C. elegans |
F26E4.7(qy103[F26E4.7::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous F26E4.7 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2668 |
C. elegans |
C16E9.1(qy104[C16E9.1::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous C16E9.1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2669 |
C. elegans |
F26E4.3(qy105[F26E4.3::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous F26E4.3 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2672 |
C. elegans |
unc-40(qy68[unc-40::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous unc-40 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2673 |
C. elegans |
unc-5(qy70[unc-5::2xmNG + LoxP]) IV. Show Description
2x mNG tag inserted into the endogenous unc-5 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2688 |
C. elegans |
fbn-1(qy107[fbn-1::mNG (internal tag) + LoxP]) III. Show Description
mNG tag inserted into the endogenous fbn-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2692 |
C. elegans |
test-1(qy108[test-1::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous test-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2698 |
C. elegans |
sax-3(qy113[sax-3::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous sax-3 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2700 |
C. elegans |
eva-1(qy114[eva-1::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous eva-1 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
