Search Strains

Sluggish, flat, slightly sterile. Derived by out-crossing parental strain VC1957. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782

hpIs587 [flp-14p::GCaMP6::wCherry + lin-15(+)]. CGaMP6 and wCherry expressed in RID, ALA, some head neurons, a mid-body neuron and a tail neuron. Reference: Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.

hpSi38 [flp-14(+) + NeoR]. Superficially wild-type. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant phenotype. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782

hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782

GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]

sra-13(zh13) mutants display stronger chemotaxis to limiting concentrations of isoamylalcohol and diacetyl than WT animals. Deletion allele. 396 bp of 5' promoter sequence and all but the last exon are removed; probably a null allele.

The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544. doi: 10.1016/j.celrep.2023.112544. PMID: 37227820. .

ctIs33 [pal-1::GFP + rol-6(su1006)]. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. ctIs33 carries a non-rescuing pal-1::GFP fusion containing ~7kb 5' of the SL1 splice site through part of exon 5 fused to GFP. GFP expression is primarily embryonic and limited to a few cells; not visible except at high magnification. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.

Limp paralyzed Unc. Larvae move slightly better. Egl. Disorganized muscle structure. Suppressed by sup-5 and sup-7.

Body muscle abnormal. Limp paralyzed or very sluggish; somewhat Egl; larvae more paralyzed. M-MATING-NO SUCCESS.

eIs2137 [sup-7(+) + Dm-hsp::lacZ] IV. lacZ expression induced by heat shock. Limited pattern (the pSHZ1 vector was originally designed for use in Drosophila, not C. elegans, and is not the best vector for expression of lacZ in the worm). This strain has predominantly historical value (as the first C. elegans strain shown to express a foreign gene). eIs2137 transgene is integrated and contains two plasmids: pAST (sup-7 amber suppressor), and pSHZ1 (lacZ driven by Drosophila heat shock promoter (S. Munro)).

muIs28 [mig-2::GFP + unc-31(+)]. muIs28 is not mapped, but probably on LG II by process of elimination.

ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.

sqIs13 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. GFP fluorescence in autophagosomes. RFP fluorescence in AWB and AWC. ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.

Formerly known as Rhabditis axei. Isolated by Elie S. Dolgin in 2006 from fungus at Limuru, Kenya (1º05'S 36º39'E); isolate number LI-OM-B-1&4. First frozen by Fitch laboratory 9/5/2006. Gonochoristic. Grows well on NGM plates and OP50 at 20-25C. Freezes easily with C. elegans protocols with >20% viability. DF5098 was verified to be R. axei by intercrossing it with DF5006 and observing that their resulting F1 and F2 hybrid offspring were healthy and fertile. At 33C, DF5098 can live for up to three days, although they developmentally arrest as late larvae or young adults, fail to produce offspring, and eventually die; in contrast, DF5006 either dies or arrests as first-stage (L1) larvae. Returning DF5098 to 20C from 33C rescues them from developmental arrest and death, and allows them to become fertile adults; in contrast, when DF5006 L1 larvae are returned to 20C, they sometimes grow to later larvae, but never grow to fertile adults. Thus, DF5098 shows clearly superior resistance to heat over DF5006; it shows somewhat lower fertility than DF5097 (which also withstands 33C) after being returned to 20C.

eeEx106 [hil-1::GFP + rol-6(su1006)]. GFP expression in body wall muscles, in the vulva sex muscles, in the marginal cells of the pharynx, in a limited number of head neurons, in the cytoplasm of excretory cells. The expression starts in the about 100-cell embryo in a few cells in the periphery in the nucleoplasm and in the nucleoli. Complex extrachromosomal arrary....pick Rollers. About 20% Rollers.

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost from the Olive Mushroom Farms near the town of Limuru, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Homozygous viable. Received from Limor Broday. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

wuIs305 [myo-3p::Queen-2m]. ATP sensor Queen-2m is expressed under the control of myo-3 promoter. Reference: Galimov et al. Cell Rep. 2018 Mar 6;22(10):2730-2741.

wuIs305 [myo-3p::Queen-2m]. Temperature sensitive dauer constitutive. Maintain at 15C. ATP sensor Queen-2m is expressed under the control of myo-3 promoter. Reference: Galimov et al. Cell Rep. 2018 Mar 6;22(10):2730-2741.

wuIs305 [myo-3p::Queen-2m]. ATP sensor Queen-2m is expressed under the control of myo-3 promoter. Reference: Galimov et al. Cell Rep. 2018 Mar 6;22(10):2730-2741.

Maintain at 15C. Temperature sensitive. Will grow at 20C, but does better at 15C (viable, somewhat Unc). At 25C: 91% of eggs arrest at lima bean.

Temperature sensitive, maintain at 15C. At 25.6C 80% of the eggs arrest at lima bean and have abnormal gut granule birefringence. Leaky at 25C. Will grow somewhat at 20C also.

Temperature sensitive, maintain at 15C. At 25C the eggs arrest at lima bean and have normal gut granule birefringence. Will grow at 20C.

Deficiency completely eliminates daf-16 coding region. Makes partial dauers on pheromone.

mgDf90 completely eliminates the daf-3 coding region.

Null allele. CRISPR-engineered deletion of the tdp-1 locus precisely eliminates all known tdp-1 exons and introns. Reference: Lins J, et al. Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants. MicroPubl Biol. 2023 Jun 6;2023:10.17912/micropub.biology.000693. doi: 10.17912/micropub.biology.000693. PMID: 37351305.

meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118

Heterozygotes are wild-type and segregate wild-type heterozygotes, glp-1(q35) homozygotes (Muv steriles), eT1 homozygotes (Unc-36), and males. glp-1(q35) has a semi-dominant multi-vulva phenotype as well as the loss-of-function Glp phenotype (sterility and embryonic lethality). The q35 mutation is a nonsense mutation that eliminates 122 C-terminal amino acids including a PEST sequence. The C terminus was thought to contain a negative regulatory domain that inactivates glp-1 in the VPCs; the inappropriate glp-1(q35) activity can substitute for lin-12 vulval fate determination. References: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99. Mango S, et al. Nature. 1991 Aug 29;352(6338):811-5.

peIs1713 [sra-6p::mCasp-1 + unc-122p::mCherry]. ASH neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739.

peIs1715 [str-1p::mCasp-1 + unc-122p::GFP]. AWB neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739.

Recessive Daf-c mutation that also causes Odr and Che defects. Maintain at 15C. [The mec-1 mutation present in the original isolates has been eliminated.] Previously known as daf-21.

Defective response to short wavelength light; response strongly reduced but not eliminated. All other characteristics seem wild type, including reponse to mechanosensory stimuli. Strong, probably null, allele. This mutation also blocks the coordinated light response of unc-31(e928) and egl-30(ad805). To identify lite-1 homozygous mutants when crossing into different backgrounds, use a fluorescence stereomicroscope with a GFP filter and zoom to the hightest magnification (60-100X) to distinguish Lite from non-Lite animals. This works best when the animals are mired in thicker parts of the food to slow their spontaneous locomotion but not their response to light. Scan animals around the edge of the food where it is thickest. Leave the lid of the plate off for a minute or so before starting to let the animals adjust to air currents.

Wild type, segregating unc-101, wild type and arrested embryos. eDf3 homozygote arrests as unhatched embryo at lima bean stage. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. [4/98: Paul Mains tested eDf3 in this strain with unc-54 and unc-59. Both resulted in complementation; therefore, there may be a problem with eDf3 in this strain.]

Wild type, segregating Unc-101 (hIn1[unc-101] homozygotes), wild type and arrested embryos. eDf4 homozygote arrests as unhatched embryo at lima bean stage. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Wild type, segregating Unc-101 (hIn1[unc-101] homozygotes), wild type and arrested embryos. eDf6 homozygote arrests as unhatched embryo at lima bean stage. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

kasEx151 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 300bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is retained, but eliminates ectopic expression in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

Very weak Egl. rgs-1=C05B7.7, a C. elegans RGS (Regulator of G protein Signaling) gene. nr2017 is a presumptive null allele. nr2017 is a 638 bp deletion of sequences whose limits are CGAGAAATTGTCAACACTAAC...GTTTGGAATGGTTTATCAGTT. The deleted material is replaced by the following 35 bp insertion: TATGTTTAAGTTAAGTTTATAGTTTAAGTTTAAAG.

rgs-2=F16H9.1, a C. elegans RGS (Regulator of G protein Signaling) gene. vs17 is a presumptive null allele. vs17 is a 1136 bp deletion of sequences with limits: ATATATATATCTCATTACTGG...AATCAAGTGTAACACTAATAT. rgs-1;rgs-2 double mutants fail to rapidly turn on egg-laying behavior when fed after starvation.

Temperature sensitive, maintain at 15C. At 25C the embryos arrest at the lima bean stage. Will grow at 20C.

mirIs92 [daf-16p::daf-16::GcNL::let-858 3'UTR + myo-2p::mCherry]. bus-17(br2) has defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. daf-16 translational reporter with green non-calcium sensitive nanolantern (GCNL). Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.

mirEx123 [myo-3p::TeNL::unc-54 3' UTR]. Maintain strain by picking animals with blue fluorescence. bus-17(br2) has mutant defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in muscles. Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.

Egg laying defective. Most progeny released, but released late (lima bean or later). Males mate poorly.

n1761 cuases a partially penetrant "rod-like" larval lethal phenotype (70% at 20C) and a partially penetrant vulvaless phenotype (30% at 20C). It is a splice site defect predicted to eliminate 62 amino acids at the C-terminus.

Undectectable levels of b-glucuronidase activity. Limp paralysed phenotype at all stages. Larvae can move slightly more than adults. Egl.

ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.