More Fields
Strain Species Genotype
CB3924 C. elegans pal-1(e2091) III; him-5(e1490) V. Show Description
Males are missing most of the rays and additional alae extend into the tail.
EM489 C. elegans pal-1(e2091) III; him-5(e1490) V; dpy-22(bx92) X. Show Description
V6 produces rays instead of alae in pal-1; sop01 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx92).
EM490 C. elegans pal-1(e2091) III; him-5(e1490) V; dpy-22(bx93) X. Show Description
V6 produces rays instead of alae in pal-1; sop01 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx93).
EM493 C. elegans sop-3(bx96) I; pal-1(e2091) III; him-5(e1490) V. Show Description
V6 produces rays instead of alae in sop-3; pal-1 mutants.
EM507 C. elegans pal-1(e2091) III; him-5(e1490) V; dpy-22(bx103) X. Show Description
V6 produces rays instead of alae in pal-1; sop-1 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx103).
EM511 C. elegans pal-1(e2091) III; him-5(e1490) V; dpy-22(bx107) X. Show Description
V6 produces rays instead of alae in pal-1; sop01 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx107).
BW1563 C. elegans pal-1(ct281)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct281 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct281 is a 4.7kb deletion removing intron 5, exon 6, and the 3'UTR of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW1566 C. elegans pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW1927 C. elegans pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III; ctIs33. Show Description
ctIs33 [pal-1::GFP + rol-6(su1006)]. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. ctIs33 carries a non-rescuing pal-1::GFP fusion containing ~7kb 5' of the SL1 splice site through part of exon 5 fused to GFP. GFP expression is primarily embryonic and limited to a few cells; not visible except at high magnification. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
VC534 C. elegans pal-1(ok690)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
C38D4.6. Deletion balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok690 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
BW2041 C. elegans pal-1(ct224) dpy-17(e164) ncl-1(e1865) unc-36(e251) III; svDp1 (III;f). Show Description
svDp1 [sur-5::GFP] (III;f). svDp1 was derived by insertion of a sur-5::GFP marker into sDp3(III;f). Pick GFP+ wild-type to maintain. svDp1 rescues ct224. ct224 homozygotes (lacking GFP expression) show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. The duplication is lost in about 30-40% of embryos. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW2063 C. elegans ceh-20(ay38) unc-36(e251) III; svDp1 (III;f). Show Description
May have unc-4(e120) mutation in background. svDp1 balances from pal-1 through unc-36 on III. svDp1 made by fusing array containing [unc-4(+) + sur-5::GFP] to sDp3(III;f).
JH2013 C. elegans unc-119(ed3) III; axIs1460. Show Description
axIs1460 [pie-1p::GFP::pal-1(genomic)::pal-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. pal-1 coding region and 3’ sequences were amplified from genomic DNA and cloned into pDONR201 to create ORF+3’ Entry Clones.
JH2236 C. elegans unc-119(ed3) III; axIs1624. Show Description
axIs1624 [pie-1p::GFP::histone H2B::pal-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
KW2196 C. elegans ckSi21 II; unc-119(ed3) III. Show Description
ckSi21 [cdk-9::GFP::pal-1 3'UTR + unc-119(+)] II. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).
KW2205 C. elegans cdk-9(tm2884) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ckSi21 II. Show Description
ckSi21 [cdk-9::mCherry::pal-1 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. hT2 segregates WT green-glowing heterozygotes and non-GFP cdk-9 homozygotes (normally arrest as L1-L2 larvae; cdk-9 homozygotes carrying ckSi21 (GFP- mCherry+) are viable but sterile. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).
KW2206 C. elegans ckSi26 I; unc-119(ed3) III. Show Description
ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).
KW2211 C. elegans ckSi26 I; cdk-12(ok3664)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).
OP380 C. elegans unc-119(tm4063) III; wgIs380. Show Description
wgIs380 [pal-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
RW10174 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10174. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10174 [pal-1::H1-wCherry + unc-119(+)].
RW10993 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs94. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs94 [pal-1::TY1::eGFP::3xFLAG(P000006_G02)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
SS712 C. elegans ife-1(bn127) III. Show Description
Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt//tgatgaaaattaattgtatt. The ife-1 gene is the third in an operon, but the deletion is contained completely within the ife-1 gene.
MLC1480 C. elegans lucIs39. Show Description
lucIs39 [tbx-37p::mNeonGreen::2xNLS::tbx-37 3'UTR + pal-1p::mScarlet-I::2xNLS::tbb-2 3'UTR + med-2p::mScarlet-I::2xNLS::tbb-2 3'UTR]. Wild-type morphology. Integrated array allows for labeling and sorting of ABa and ABp descendants by FACS. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421