AV39 |
C. elegans |
mnDp66 (X;I); meDf3 X. Show Description
Produces 32% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf3 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf3/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf3 can be followed in heterozygotes by this weak Him phenotype.
|
|
CB2769 |
C. elegans |
eDf3/eDf24 I. Show Description
Heterozygotes are WT and segregate WT, dead eggs, and larval lethal (eDf24 homozygotes). eDf24 = let(e2000).
|
|
KR2405 |
C. elegans |
eDf3/hIn1 [unc-101(sy241)] I. Show Description
Wild type, segregating unc-101, wild type and arrested embryos. eDf3 homozygote arrests as unhatched embryo at lima bean stage. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. [4/98: Paul Mains tested eDf3 in this strain with unc-54 and unc-59. Both resulted in complementation; therefore, there may be a problem with eDf3 in this strain.]
|
|
RG3354 |
C. elegans |
veDf3 [LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] V. Show Description
Homozygous viable. Deletion of 4002 bp removes his-8, his-7, his-6, his-5, and his-39, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGGTGATTTGCTTTCAGCAATTGAATGC ; Right flanking sequence: GCATTCAATTGCTGAAAGCAAATCACCGAA. his-8/his-39 sgRNA #1: ATTGAATGCTTACTTGCTAG; his-8/his-39 sgRNA #1: ATTGAATGCTTACTTGCTAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|