Strain Information

Name OH18501   View On Wormbase
Species C. elegans
Genotypeaex-1(ot1357) I.
Descriptionot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit:ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGG
CCGACATAAt.
Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
MutagenCrispr/Cas9
Outcrossedx0
Made bySurojit Sural
Laboratory OH
Reference Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
Sign in or register an account if you want to order this strain.