Strain Information
| Name | OH18501 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | aex-1(ot1357) I. |
| Description | ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit:ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGG CCGACATAAt. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Surojit Sural |
| Laboratory | OH |
| Reference | Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
Sign in
or
register an account if you want to order this strain.