Strain Information

Name VC3809   View On Wormbase Documentation for VC3809 gkDf65 nspc-1 to nspc-7
Species C. elegans
GenotypegkDf65[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] X.
DescriptionHomozygous viable. Deletion of 7821 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTGTATAAGATTTTATTAAATATGTGCCA; Right flanking sequence: CGGTGAAGTATTTGACTAGATGACCGACGT. See WormBase Rearrangement gkDf65 for details.
MutagenCrispr/Cas9
Outcrossedx0
Made byVancouver KO Group
Laboratory DM
Reference n/a
Sign in or register an account if you want to order this strain.