Strain Information

Name VC4003   View On Wormbase Documentation for VC4003 gk5076 F54D1.1
Species C. elegans
GenotypeF54D1.1(gk5076[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
DescriptionHomozygous viable. Deletion of 1219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCCAAGTCAATATTTTCATTATTTCCTCAT; Right flanking sequence: ATTTGTTACTGAAATCTCAGATAACAATGC. See WormBase Variation gk5076 for details.
MutagenCrispr/Cas9
Outcrossedx0
Made byVancouver KO Group
Laboratory DM
Reference n/a
Sign in or register an account if you want to order this strain.