Strain Information
Name | VC3959 View On Wormbase Documentation for VC3959 gk5037 ubc-7 |
---|---|
Species | C. elegans |
Genotype | ubc-7(gk5037[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. |
Description | Homozygous viable. Deletion of 551 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TATTTCGGTTATTTTTCATTGTTTAGACGA; Right flanking sequence: TAGGGAGGATTGCTCCATCTATCTAGAAAT. See WormBase Variation gk5037 for details. |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | Vancouver KO Group |
Laboratory | DM |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.