Strain Information

Name RG3071   View On Wormbase
Species C. elegans
Genotypemlt-2(ve571[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V.
DescriptionumnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Let. Deletion of 2897 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve571 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gttttcattaaatcaaaatttgtgccacca ; Right flanking sequence: GCAAACCGTCGATctttaagattgtaacat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
MutagenCrispr/Cas9
Outcrossedx0
Made byRG KO Group
Laboratory RG
Reference n/a
Sign in or register an account if you want to order this strain.